Incidental Mutation 'R7496:Olfr695'
ID581074
Institutional Source Beutler Lab
Gene Symbol Olfr695
Ensembl Gene ENSMUSG00000108948
Gene Nameolfactory receptor 695
SynonymsGA_x6K02T2PBJ9-9092181-9091234, MOR283-6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R7496 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location106711031-106716396 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106714228 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 151 (L151P)
Ref Sequence ENSEMBL: ENSMUSP00000149773 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000216868
AA Change: L151P

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 T C 16: 56,732,857 I626V probably benign Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Ago1 C T 4: 126,461,752 R88H probably benign Het
Ankrd6 C T 4: 32,810,299 D461N probably damaging Het
Bcl2l14 A G 6: 134,427,454 N202D probably benign Het
Bnip2 A G 9: 70,003,404 I245V probably damaging Het
Cdhr3 T C 12: 33,060,265 D340G probably damaging Het
Dchs1 T C 7: 105,761,859 E1653G probably damaging Het
Dhdds C A 4: 133,971,254 Q256H possibly damaging Het
Dsc2 A T 18: 20,035,394 C669* probably null Het
Dync2h1 T C 9: 7,135,015 probably null Het
Dysf T C 6: 84,067,478 S276P probably benign Het
Galc A T 12: 98,259,238 L31* probably null Het
Gm527 C T 12: 64,922,410 R204C possibly damaging Het
Hivep3 G A 4: 120,132,402 D2017N probably benign Het
Inf2 C T 12: 112,600,318 R106C probably damaging Het
Itgb1 A G 8: 128,720,305 K434E probably benign Het
Lamb1 A C 12: 31,300,021 N700T probably benign Het
Macc1 T G 12: 119,446,999 F501V possibly damaging Het
Man2a2 G A 7: 80,352,997 H1079Y probably damaging Het
Nedd4l G A 18: 65,080,018 V82I possibly damaging Het
Nr2f1 T C 13: 78,195,242 E301G probably damaging Het
Olfr1129 A G 2: 87,575,371 R96G probably damaging Het
Olfr1246 T C 2: 89,590,696 I140V probably benign Het
Pdgfrb G A 18: 61,078,932 V844I possibly damaging Het
Pkd1l2 T C 8: 117,060,594 E570G possibly damaging Het
R3hdm4 A T 10: 79,916,874 L4Q probably damaging Het
Rb1cc1 A G 1: 6,248,191 K639R probably null Het
Robo3 A T 9: 37,427,825 C257S probably damaging Het
Rprd2 A T 3: 95,765,775 L772Q probably damaging Het
Sall2 T C 14: 52,315,561 D59G possibly damaging Het
Sall3 T C 18: 80,973,364 T450A probably benign Het
Sdhd T C 9: 50,597,085 *160W probably null Het
Sgca T C 11: 94,971,244 E194G possibly damaging Het
Shtn1 G A 19: 59,028,184 R228C probably damaging Het
Skor1 A T 9: 63,146,850 S22T probably benign Het
Slc26a8 C A 17: 28,644,850 G645V probably benign Het
Smtn T C 11: 3,529,988 E411G probably damaging Het
Sox17 A G 1: 4,492,327 Y217H probably damaging Het
Syk A G 13: 52,612,416 Q179R probably benign Het
Tpp2 A G 1: 43,983,517 I959M probably benign Het
Trim65 T A 11: 116,126,316 N440I probably damaging Het
Ubr2 C T 17: 46,990,991 probably null Het
Ush2a T C 1: 188,351,087 S276P possibly damaging Het
Vmn1r61 A G 7: 5,610,431 S295P probably benign Het
Wdhd1 T C 14: 47,274,024 Q77R probably benign Het
Xylb T A 9: 119,391,816 *552R probably null Het
Zfp932 C T 5: 110,008,828 P131S probably damaging Het
Other mutations in Olfr695
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01010:Olfr695 APN 7 106874253 utr 5 prime probably benign
IGL02143:Olfr695 APN 7 106873973 missense probably benign 0.02
R0492:Olfr695 UTSW 7 106873877 missense probably damaging 1.00
R1816:Olfr695 UTSW 7 106873488 nonsense probably null
R1834:Olfr695 UTSW 7 106874141 missense probably damaging 1.00
R2011:Olfr695 UTSW 7 106873427 missense probably benign 0.03
R3434:Olfr695 UTSW 7 106873769 missense probably benign 0.01
R3842:Olfr695 UTSW 7 106874095 missense probably benign 0.07
R4405:Olfr695 UTSW 7 106873373 missense probably damaging 1.00
R4742:Olfr695 UTSW 7 106873428 missense probably damaging 0.99
R4815:Olfr695 UTSW 7 106874237 missense probably benign
R4851:Olfr695 UTSW 7 106874014 missense probably damaging 1.00
R4856:Olfr695 UTSW 7 106873970 missense probably damaging 1.00
R5663:Olfr695 UTSW 7 106873670 missense probably benign 0.43
R5783:Olfr695 UTSW 7 106873334 missense probably damaging 0.97
R6552:Olfr695 UTSW 7 106714643 small deletion probably benign
R6640:Olfr695 UTSW 7 106714040 missense probably damaging 1.00
R6798:Olfr695 UTSW 7 106714195 missense probably damaging 1.00
R7365:Olfr695 UTSW 7 106713964 missense probably benign 0.03
R7923:Olfr695 UTSW 7 106714442 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTGAGGGCATATGGAGCAC -3'
(R):5'- TCATTCCCAAGGCCGTACTAG -3'

Sequencing Primer
(F):5'- TCAGGATGGCCGCAAGAGC -3'
(R):5'- AACACTATCTCATTTGGGGGATG -3'
Posted On2019-10-17