Incidental Mutation 'R7496:Sdhd'
ID581078
Institutional Source Beutler Lab
Gene Symbol Sdhd
Ensembl Gene ENSMUSG00000000171
Gene Namesuccinate dehydrogenase complex, subunit D, integral membrane protein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7496 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location50596357-50603812 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 50597085 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 160 (*160W)
Ref Sequence ENSEMBL: ENSMUSP00000000175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000175]
Predicted Effect probably null
Transcript: ENSMUST00000000175
AA Change: *160W
SMART Domains Protein: ENSMUSP00000000175
Gene: ENSMUSG00000000171
AA Change: *160W

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
Pfam:CybS 33 158 7.1e-27 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of complex II of the respiratory chain, which is responsible for the oxidation of succinate. The encoded protein is one of two integral membrane proteins anchoring the complex to the matrix side of the mitochondrial inner membrane. Mutations in this gene are associated with the formation of tumors, including hereditary paraganglioma. Transmission of disease occurs almost exclusively through the paternal allele, suggesting that this locus may be maternally imprinted. There are pseudogenes for this gene on chromosomes 1, 2, 3, 7, and 18. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2013]
PHENOTYPE: Homozygous null mice die before E7.5. Heterozygotes show a deficiency in succinate dehydrogenase activity and an abnormal enhancement of resting carotid body activity due to a decrease of potassium conductance and persistent calcium influx into glomus cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 T C 16: 56,732,857 I626V probably benign Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Ago1 C T 4: 126,461,752 R88H probably benign Het
Ankrd6 C T 4: 32,810,299 D461N probably damaging Het
Bcl2l14 A G 6: 134,427,454 N202D probably benign Het
Bnip2 A G 9: 70,003,404 I245V probably damaging Het
Cdhr3 T C 12: 33,060,265 D340G probably damaging Het
Dchs1 T C 7: 105,761,859 E1653G probably damaging Het
Dhdds C A 4: 133,971,254 Q256H possibly damaging Het
Dsc2 A T 18: 20,035,394 C669* probably null Het
Dync2h1 T C 9: 7,135,015 probably null Het
Dysf T C 6: 84,067,478 S276P probably benign Het
Galc A T 12: 98,259,238 L31* probably null Het
Gm527 C T 12: 64,922,410 R204C possibly damaging Het
Hivep3 G A 4: 120,132,402 D2017N probably benign Het
Inf2 C T 12: 112,600,318 R106C probably damaging Het
Itgb1 A G 8: 128,720,305 K434E probably benign Het
Lamb1 A C 12: 31,300,021 N700T probably benign Het
Macc1 T G 12: 119,446,999 F501V possibly damaging Het
Man2a2 G A 7: 80,352,997 H1079Y probably damaging Het
Nedd4l G A 18: 65,080,018 V82I possibly damaging Het
Nr2f1 T C 13: 78,195,242 E301G probably damaging Het
Olfr1129 A G 2: 87,575,371 R96G probably damaging Het
Olfr1246 T C 2: 89,590,696 I140V probably benign Het
Olfr695 A G 7: 106,714,228 L151P probably benign Het
Pdgfrb G A 18: 61,078,932 V844I possibly damaging Het
Pkd1l2 T C 8: 117,060,594 E570G possibly damaging Het
R3hdm4 A T 10: 79,916,874 L4Q probably damaging Het
Rb1cc1 A G 1: 6,248,191 K639R probably null Het
Robo3 A T 9: 37,427,825 C257S probably damaging Het
Rprd2 A T 3: 95,765,775 L772Q probably damaging Het
Sall2 T C 14: 52,315,561 D59G possibly damaging Het
Sall3 T C 18: 80,973,364 T450A probably benign Het
Sgca T C 11: 94,971,244 E194G possibly damaging Het
Shtn1 G A 19: 59,028,184 R228C probably damaging Het
Skor1 A T 9: 63,146,850 S22T probably benign Het
Slc26a8 C A 17: 28,644,850 G645V probably benign Het
Smtn T C 11: 3,529,988 E411G probably damaging Het
Sox17 A G 1: 4,492,327 Y217H probably damaging Het
Syk A G 13: 52,612,416 Q179R probably benign Het
Tpp2 A G 1: 43,983,517 I959M probably benign Het
Trim65 T A 11: 116,126,316 N440I probably damaging Het
Ubr2 C T 17: 46,990,991 probably null Het
Ush2a T C 1: 188,351,087 S276P possibly damaging Het
Vmn1r61 A G 7: 5,610,431 S295P probably benign Het
Wdhd1 T C 14: 47,274,024 Q77R probably benign Het
Xylb T A 9: 119,391,816 *552R probably null Het
Zfp932 C T 5: 110,008,828 P131S probably damaging Het
Other mutations in Sdhd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02365:Sdhd APN 9 50598825 missense possibly damaging 0.93
R0600:Sdhd UTSW 9 50603764 missense possibly damaging 0.48
R0682:Sdhd UTSW 9 50600605 missense probably benign 0.07
R1776:Sdhd UTSW 9 50597200 missense probably benign 0.23
R7214:Sdhd UTSW 9 50597233 missense possibly damaging 0.87
R8464:Sdhd UTSW 9 50597131 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACACAGACTCACGAATGGTC -3'
(R):5'- TGTCTGCATGGCCTCTAAC -3'

Sequencing Primer
(F):5'- GAATGGTCGAACCTAACTCCTC -3'
(R):5'- GGCCTCTAACTGCCCTTGTG -3'
Posted On2019-10-17