Incidental Mutation 'R7496:Trim65'
ID581085
Institutional Source Beutler Lab
Gene Symbol Trim65
Ensembl Gene ENSMUSG00000054517
Gene Nametripartite motif-containing 65
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7496 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location116121846-116131128 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116126316 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 440 (N440I)
Ref Sequence ENSEMBL: ENSMUSP00000063410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067632] [ENSMUST00000106440]
Predicted Effect probably damaging
Transcript: ENSMUST00000067632
AA Change: N440I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000063410
Gene: ENSMUSG00000054517
AA Change: N440I

DomainStartEndE-ValueType
RING 13 51 2.47e-9 SMART
low complexity region 69 85 N/A INTRINSIC
Blast:BBOX 94 132 3e-10 BLAST
coiled coil region 140 175 N/A INTRINSIC
low complexity region 282 298 N/A INTRINSIC
PRY 333 383 3.67e-3 SMART
Pfam:SPRY 386 505 1.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106440
SMART Domains Protein: ENSMUSP00000102048
Gene: ENSMUSG00000054517

DomainStartEndE-ValueType
RING 13 51 2.47e-9 SMART
low complexity region 69 85 N/A INTRINSIC
Blast:BBOX 94 132 2e-10 BLAST
coiled coil region 140 175 N/A INTRINSIC
low complexity region 282 298 N/A INTRINSIC
PRY 333 383 3.67e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 T C 16: 56,732,857 I626V probably benign Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Ago1 C T 4: 126,461,752 R88H probably benign Het
Ankrd6 C T 4: 32,810,299 D461N probably damaging Het
Bcl2l14 A G 6: 134,427,454 N202D probably benign Het
Bnip2 A G 9: 70,003,404 I245V probably damaging Het
Cdhr3 T C 12: 33,060,265 D340G probably damaging Het
Dchs1 T C 7: 105,761,859 E1653G probably damaging Het
Dhdds C A 4: 133,971,254 Q256H possibly damaging Het
Dsc2 A T 18: 20,035,394 C669* probably null Het
Dync2h1 T C 9: 7,135,015 probably null Het
Dysf T C 6: 84,067,478 S276P probably benign Het
Galc A T 12: 98,259,238 L31* probably null Het
Gm527 C T 12: 64,922,410 R204C possibly damaging Het
Hivep3 G A 4: 120,132,402 D2017N probably benign Het
Inf2 C T 12: 112,600,318 R106C probably damaging Het
Itgb1 A G 8: 128,720,305 K434E probably benign Het
Lamb1 A C 12: 31,300,021 N700T probably benign Het
Macc1 T G 12: 119,446,999 F501V possibly damaging Het
Man2a2 G A 7: 80,352,997 H1079Y probably damaging Het
Nedd4l G A 18: 65,080,018 V82I possibly damaging Het
Nr2f1 T C 13: 78,195,242 E301G probably damaging Het
Olfr1129 A G 2: 87,575,371 R96G probably damaging Het
Olfr1246 T C 2: 89,590,696 I140V probably benign Het
Olfr695 A G 7: 106,714,228 L151P probably benign Het
Pdgfrb G A 18: 61,078,932 V844I possibly damaging Het
Pkd1l2 T C 8: 117,060,594 E570G possibly damaging Het
R3hdm4 A T 10: 79,916,874 L4Q probably damaging Het
Rb1cc1 A G 1: 6,248,191 K639R probably null Het
Robo3 A T 9: 37,427,825 C257S probably damaging Het
Rprd2 A T 3: 95,765,775 L772Q probably damaging Het
Sall2 T C 14: 52,315,561 D59G possibly damaging Het
Sall3 T C 18: 80,973,364 T450A probably benign Het
Sdhd T C 9: 50,597,085 *160W probably null Het
Sgca T C 11: 94,971,244 E194G possibly damaging Het
Shtn1 G A 19: 59,028,184 R228C probably damaging Het
Skor1 A T 9: 63,146,850 S22T probably benign Het
Slc26a8 C A 17: 28,644,850 G645V probably benign Het
Smtn T C 11: 3,529,988 E411G probably damaging Het
Sox17 A G 1: 4,492,327 Y217H probably damaging Het
Syk A G 13: 52,612,416 Q179R probably benign Het
Tpp2 A G 1: 43,983,517 I959M probably benign Het
Ubr2 C T 17: 46,990,991 probably null Het
Ush2a T C 1: 188,351,087 S276P possibly damaging Het
Vmn1r61 A G 7: 5,610,431 S295P probably benign Het
Wdhd1 T C 14: 47,274,024 Q77R probably benign Het
Xylb T A 9: 119,391,816 *552R probably null Het
Zfp932 C T 5: 110,008,828 P131S probably damaging Het
Other mutations in Trim65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Trim65 APN 11 116126509 missense probably damaging 1.00
PIT4531001:Trim65 UTSW 11 116127709 missense possibly damaging 0.85
R0105:Trim65 UTSW 11 116126066 makesense probably null
R0126:Trim65 UTSW 11 116124604 splice site probably benign
R0268:Trim65 UTSW 11 116126644 splice site probably benign
R0647:Trim65 UTSW 11 116128210 missense possibly damaging 0.92
R2234:Trim65 UTSW 11 116130677 missense possibly damaging 0.91
R2235:Trim65 UTSW 11 116130677 missense possibly damaging 0.91
R4011:Trim65 UTSW 11 116127703 missense probably benign 0.00
R4086:Trim65 UTSW 11 116126479 nonsense probably null
R4088:Trim65 UTSW 11 116126479 nonsense probably null
R4089:Trim65 UTSW 11 116126479 nonsense probably null
R4434:Trim65 UTSW 11 116127609 nonsense probably null
R5407:Trim65 UTSW 11 116126080 missense probably benign
R5947:Trim65 UTSW 11 116128282 missense probably damaging 0.99
R6299:Trim65 UTSW 11 116126551 missense probably benign 0.00
R7248:Trim65 UTSW 11 116127708 missense probably benign 0.01
R7336:Trim65 UTSW 11 116128290 missense probably benign 0.00
R7835:Trim65 UTSW 11 116130929 missense probably damaging 1.00
R7849:Trim65 UTSW 11 116126256 missense probably damaging 0.99
R8143:Trim65 UTSW 11 116126461 missense probably benign 0.09
R8195:Trim65 UTSW 11 116126211 missense probably benign 0.04
R8783:Trim65 UTSW 11 116126317 missense probably damaging 1.00
X0061:Trim65 UTSW 11 116126571 missense probably benign 0.39
X0066:Trim65 UTSW 11 116130846 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- CCTTCTAGAAGCTAGAGGTGGG -3'
(R):5'- ACTGGACAACATTACTGGGAG -3'

Sequencing Primer
(F):5'- TGGCACAGAGTAAGGGTCCTC -3'
(R):5'- CAACATTACTGGGAGGTACGTGTC -3'
Posted On2019-10-17