Incidental Mutation 'R7496:Syk'
ID581092
Institutional Source Beutler Lab
Gene Symbol Syk
Ensembl Gene ENSMUSG00000021457
Gene Namespleen tyrosine kinase
SynonymsSykb
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7496 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location52583173-52648792 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52612416 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 179 (Q179R)
Ref Sequence ENSEMBL: ENSMUSP00000060828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055087] [ENSMUST00000118756] [ENSMUST00000120135]
Predicted Effect probably benign
Transcript: ENSMUST00000055087
AA Change: Q179R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000060828
Gene: ENSMUSG00000021457
AA Change: Q179R

DomainStartEndE-ValueType
SH2 12 97 4.51e-26 SMART
SH2 165 249 5.06e-29 SMART
TyrKc 365 620 7.61e-120 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000118756
AA Change: Q179R

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112914
Gene: ENSMUSG00000021457
AA Change: Q179R

DomainStartEndE-ValueType
SH2 12 97 4.51e-26 SMART
SH2 165 249 5.06e-29 SMART
TyrKc 342 582 2.68e-106 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120135
AA Change: Q179R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113852
Gene: ENSMUSG00000021457
AA Change: Q179R

DomainStartEndE-ValueType
SH2 12 97 4.51e-26 SMART
SH2 165 249 5.06e-29 SMART
TyrKc 365 620 7.61e-120 SMART
Meta Mutation Damage Score 0.2004 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of non-receptor type Tyr protein kinases. This protein is widely expressed in hematopoietic cells and is involved in coupling activated immunoreceptors to downstream signaling events that mediate diverse cellular responses, including proliferation, differentiation, and phagocytosis. It is thought to be a modulator of epithelial cell growth and a potential tumour suppressor in human breast carcinomas. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous null mice have high rates of postnatal lethality, exhibit developmental defects of B cells, T cells and osteoclasts, and have defective dendritic cell cross-presentation of antigens from necrotic cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 T C 16: 56,732,857 I626V probably benign Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Ago1 C T 4: 126,461,752 R88H probably benign Het
Ankrd6 C T 4: 32,810,299 D461N probably damaging Het
Bcl2l14 A G 6: 134,427,454 N202D probably benign Het
Bnip2 A G 9: 70,003,404 I245V probably damaging Het
Cdhr3 T C 12: 33,060,265 D340G probably damaging Het
Dchs1 T C 7: 105,761,859 E1653G probably damaging Het
Dhdds C A 4: 133,971,254 Q256H possibly damaging Het
Dsc2 A T 18: 20,035,394 C669* probably null Het
Dync2h1 T C 9: 7,135,015 probably null Het
Dysf T C 6: 84,067,478 S276P probably benign Het
Galc A T 12: 98,259,238 L31* probably null Het
Gm527 C T 12: 64,922,410 R204C possibly damaging Het
Hivep3 G A 4: 120,132,402 D2017N probably benign Het
Inf2 C T 12: 112,600,318 R106C probably damaging Het
Itgb1 A G 8: 128,720,305 K434E probably benign Het
Lamb1 A C 12: 31,300,021 N700T probably benign Het
Macc1 T G 12: 119,446,999 F501V possibly damaging Het
Man2a2 G A 7: 80,352,997 H1079Y probably damaging Het
Nedd4l G A 18: 65,080,018 V82I possibly damaging Het
Nr2f1 T C 13: 78,195,242 E301G probably damaging Het
Olfr1129 A G 2: 87,575,371 R96G probably damaging Het
Olfr1246 T C 2: 89,590,696 I140V probably benign Het
Olfr695 A G 7: 106,714,228 L151P probably benign Het
Pdgfrb G A 18: 61,078,932 V844I possibly damaging Het
Pkd1l2 T C 8: 117,060,594 E570G possibly damaging Het
R3hdm4 A T 10: 79,916,874 L4Q probably damaging Het
Rb1cc1 A G 1: 6,248,191 K639R probably null Het
Robo3 A T 9: 37,427,825 C257S probably damaging Het
Rprd2 A T 3: 95,765,775 L772Q probably damaging Het
Sall2 T C 14: 52,315,561 D59G possibly damaging Het
Sall3 T C 18: 80,973,364 T450A probably benign Het
Sdhd T C 9: 50,597,085 *160W probably null Het
Sgca T C 11: 94,971,244 E194G possibly damaging Het
Shtn1 G A 19: 59,028,184 R228C probably damaging Het
Skor1 A T 9: 63,146,850 S22T probably benign Het
Slc26a8 C A 17: 28,644,850 G645V probably benign Het
Smtn T C 11: 3,529,988 E411G probably damaging Het
Sox17 A G 1: 4,492,327 Y217H probably damaging Het
Tpp2 A G 1: 43,983,517 I959M probably benign Het
Trim65 T A 11: 116,126,316 N440I probably damaging Het
Ubr2 C T 17: 46,990,991 probably null Het
Ush2a T C 1: 188,351,087 S276P possibly damaging Het
Vmn1r61 A G 7: 5,610,431 S295P probably benign Het
Wdhd1 T C 14: 47,274,024 Q77R probably benign Het
Xylb T A 9: 119,391,816 *552R probably null Het
Zfp932 C T 5: 110,008,828 P131S probably damaging Het
Other mutations in Syk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01478:Syk APN 13 52624748 missense probably benign 0.00
IGL01522:Syk APN 13 52643061 missense probably benign
IGL01957:Syk APN 13 52631740 missense probably benign
IGL01962:Syk APN 13 52610957 missense probably damaging 1.00
IGL02613:Syk APN 13 52643040 missense probably damaging 0.97
IGL02824:Syk APN 13 52623283 splice site probably benign
IGL03130:Syk APN 13 52622732 missense probably benign 0.12
Apricot UTSW 13 52640733 missense probably damaging 1.00
Poppy UTSW 13 52640733 missense probably damaging 1.00
Sisyphus UTSW 13 52640790 missense probably damaging 1.00
H8562:Syk UTSW 13 52640621 missense probably damaging 1.00
R0091:Syk UTSW 13 52640733 missense probably damaging 1.00
R0346:Syk UTSW 13 52640659 missense probably damaging 1.00
R1888:Syk UTSW 13 52640790 missense probably damaging 1.00
R1888:Syk UTSW 13 52640790 missense probably damaging 1.00
R1917:Syk UTSW 13 52622708 missense probably damaging 1.00
R2001:Syk UTSW 13 52611238 missense probably benign 0.21
R2919:Syk UTSW 13 52611121 missense probably benign
R3413:Syk UTSW 13 52631739 missense probably benign
R3695:Syk UTSW 13 52622765 splice site probably null
R4363:Syk UTSW 13 52640730 missense probably damaging 1.00
R4754:Syk UTSW 13 52612259 intron probably benign
R4755:Syk UTSW 13 52641986 missense probably benign 0.25
R4806:Syk UTSW 13 52632927 missense probably benign 0.14
R4817:Syk UTSW 13 52611206 missense probably benign 0.03
R4903:Syk UTSW 13 52611081 missense probably damaging 1.00
R4997:Syk UTSW 13 52612448 nonsense probably null
R5066:Syk UTSW 13 52641982 missense possibly damaging 0.49
R5114:Syk UTSW 13 52611035 missense probably damaging 1.00
R5267:Syk UTSW 13 52641926 missense probably benign 0.05
R5323:Syk UTSW 13 52631717 missense probably benign 0.00
R5705:Syk UTSW 13 52611047 missense probably benign 0.03
R6190:Syk UTSW 13 52611053 missense probably damaging 0.97
R6892:Syk UTSW 13 52632898 missense probably benign 0.00
R6932:Syk UTSW 13 52612459 splice site probably null
R6977:Syk UTSW 13 52633058 missense probably benign 0.00
R7650:Syk UTSW 13 52611095 missense probably benign 0.24
R8081:Syk UTSW 13 52638159 missense probably benign 0.00
R8199:Syk UTSW 13 52624732 missense probably benign 0.00
R8350:Syk UTSW 13 52620899 missense probably damaging 1.00
R8381:Syk UTSW 13 52633049 missense probably benign 0.08
R8420:Syk UTSW 13 52624727 missense probably benign 0.02
R8450:Syk UTSW 13 52620899 missense probably damaging 1.00
Z1177:Syk UTSW 13 52632913 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GTGTTGATAGGACCTGGGAC -3'
(R):5'- CAATCTTTACGGGCAGGCTAG -3'

Sequencing Primer
(F):5'- ACAGATGGGTCTAATGTCTTTCTACC -3'
(R):5'- TCTTTACGGGCAGGCTAGATAAAAC -3'
Posted On2019-10-17