Incidental Mutation 'R7496:Nr2f1'
ID581093
Institutional Source Beutler Lab
Gene Symbol Nr2f1
Ensembl Gene ENSMUSG00000069171
Gene Namenuclear receptor subfamily 2, group F, member 1
SynonymsErbal3, COUP-TF1, Tcfcoup1, COUP-TFI
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7496 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location78188973-78199757 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78195242 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 301 (E301G)
Ref Sequence ENSEMBL: ENSMUSP00000089036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091458] [ENSMUST00000125176] [ENSMUST00000127137] [ENSMUST00000150498] [ENSMUST00000224798]
Predicted Effect probably damaging
Transcript: ENSMUST00000091458
AA Change: E301G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000089036
Gene: ENSMUSG00000069171
AA Change: E301G

DomainStartEndE-ValueType
low complexity region 16 65 N/A INTRINSIC
low complexity region 68 79 N/A INTRINSIC
ZnF_C4 80 151 3.01e-39 SMART
HOLI 218 378 5.16e-47 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125176
AA Change: E154G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000122618
Gene: ENSMUSG00000069171
AA Change: E154G

DomainStartEndE-ValueType
HOLI 71 231 5.16e-47 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000127137
AA Change: E144G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133704
Gene: ENSMUSG00000069171
AA Change: E144G

DomainStartEndE-ValueType
HOLI 61 221 5.16e-47 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000150498
AA Change: E144G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118161
Gene: ENSMUSG00000069171
AA Change: E144G

DomainStartEndE-ValueType
HOLI 61 221 5.16e-47 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224798
Meta Mutation Damage Score 0.5732 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear hormone receptor and transcriptional regulator. The encoded protein acts as a homodimer and binds to 5'-AGGTCA-3' repeats. Defects in this gene are a cause of Bosch-Boonstra optic atrophy syndrome (BBOAS). [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygotes for a null allele die perinatally with axon guidance defects in all forebrain commissures. Homozygotes for another null allele show neonatal death, impaired cranial ganglion IX formation and axon guidance, increased cochlear HC and support cell number, and altered cortex regionalization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 T C 16: 56,732,857 I626V probably benign Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Ago1 C T 4: 126,461,752 R88H probably benign Het
Ankrd6 C T 4: 32,810,299 D461N probably damaging Het
Bcl2l14 A G 6: 134,427,454 N202D probably benign Het
Bnip2 A G 9: 70,003,404 I245V probably damaging Het
Cdhr3 T C 12: 33,060,265 D340G probably damaging Het
Dchs1 T C 7: 105,761,859 E1653G probably damaging Het
Dhdds C A 4: 133,971,254 Q256H possibly damaging Het
Dsc2 A T 18: 20,035,394 C669* probably null Het
Dync2h1 T C 9: 7,135,015 probably null Het
Dysf T C 6: 84,067,478 S276P probably benign Het
Galc A T 12: 98,259,238 L31* probably null Het
Gm527 C T 12: 64,922,410 R204C possibly damaging Het
Hivep3 G A 4: 120,132,402 D2017N probably benign Het
Inf2 C T 12: 112,600,318 R106C probably damaging Het
Itgb1 A G 8: 128,720,305 K434E probably benign Het
Lamb1 A C 12: 31,300,021 N700T probably benign Het
Macc1 T G 12: 119,446,999 F501V possibly damaging Het
Man2a2 G A 7: 80,352,997 H1079Y probably damaging Het
Nedd4l G A 18: 65,080,018 V82I possibly damaging Het
Olfr1129 A G 2: 87,575,371 R96G probably damaging Het
Olfr1246 T C 2: 89,590,696 I140V probably benign Het
Olfr695 A G 7: 106,714,228 L151P probably benign Het
Pdgfrb G A 18: 61,078,932 V844I possibly damaging Het
Pkd1l2 T C 8: 117,060,594 E570G possibly damaging Het
R3hdm4 A T 10: 79,916,874 L4Q probably damaging Het
Rb1cc1 A G 1: 6,248,191 K639R probably null Het
Robo3 A T 9: 37,427,825 C257S probably damaging Het
Rprd2 A T 3: 95,765,775 L772Q probably damaging Het
Sall2 T C 14: 52,315,561 D59G possibly damaging Het
Sall3 T C 18: 80,973,364 T450A probably benign Het
Sdhd T C 9: 50,597,085 *160W probably null Het
Sgca T C 11: 94,971,244 E194G possibly damaging Het
Shtn1 G A 19: 59,028,184 R228C probably damaging Het
Skor1 A T 9: 63,146,850 S22T probably benign Het
Slc26a8 C A 17: 28,644,850 G645V probably benign Het
Smtn T C 11: 3,529,988 E411G probably damaging Het
Sox17 A G 1: 4,492,327 Y217H probably damaging Het
Syk A G 13: 52,612,416 Q179R probably benign Het
Tpp2 A G 1: 43,983,517 I959M probably benign Het
Trim65 T A 11: 116,126,316 N440I probably damaging Het
Ubr2 C T 17: 46,990,991 probably null Het
Ush2a T C 1: 188,351,087 S276P possibly damaging Het
Vmn1r61 A G 7: 5,610,431 S295P probably benign Het
Wdhd1 T C 14: 47,274,024 Q77R probably benign Het
Xylb T A 9: 119,391,816 *552R probably null Het
Zfp932 C T 5: 110,008,828 P131S probably damaging Het
Other mutations in Nr2f1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Nr2f1 APN 13 78189833 missense probably damaging 1.00
IGL00553:Nr2f1 APN 13 78198242 missense probably damaging 1.00
IGL00821:Nr2f1 APN 13 78198114 unclassified probably benign
IGL02346:Nr2f1 APN 13 78195408 missense probably damaging 1.00
IGL02586:Nr2f1 APN 13 78195156 unclassified probably benign
IGL02587:Nr2f1 APN 13 78195156 unclassified probably benign
IGL02588:Nr2f1 APN 13 78195156 unclassified probably benign
R1470:Nr2f1 UTSW 13 78198165 missense possibly damaging 0.94
R1470:Nr2f1 UTSW 13 78198165 missense possibly damaging 0.94
R1865:Nr2f1 UTSW 13 78189926 missense probably damaging 1.00
R1959:Nr2f1 UTSW 13 78189816 missense probably damaging 1.00
R2284:Nr2f1 UTSW 13 78195462 missense probably damaging 1.00
R3861:Nr2f1 UTSW 13 78195675 nonsense probably null
R4542:Nr2f1 UTSW 13 78189821 missense probably damaging 1.00
R6248:Nr2f1 UTSW 13 78196492 intron probably benign
R6285:Nr2f1 UTSW 13 78195663 missense probably benign 0.01
R7305:Nr2f1 UTSW 13 78195179 missense probably damaging 1.00
R7653:Nr2f1 UTSW 13 78195597 missense probably benign 0.32
R7884:Nr2f1 UTSW 13 78189869 missense probably benign 0.03
R7954:Nr2f1 UTSW 13 78189994 missense probably damaging 1.00
R8030:Nr2f1 UTSW 13 78195446 missense probably benign 0.36
R8875:Nr2f1 UTSW 13 78189851 missense probably damaging 1.00
R8959:Nr2f1 UTSW 13 78189754 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGACGATCCACAATGCCCTG -3'
(R):5'- GCATCGAGAACATCTGCGAG -3'

Sequencing Primer
(F):5'- TACGCTCCCAAGATGGCAG -3'
(R):5'- ATCTGCAGATCACGGACCAGG -3'
Posted On2019-10-17