Mutagenetix > Incidental Mutation

Incidental Mutation 'R7496:Sall2'

581096

Institutional Source

Beutler Lab

Gene Symbol

Sall2

Ensembl Gene

ENSMUSG00000049532

Gene Name

spalt like transcription factor 2

Synonyms

Msal-2

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7496 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

52311172-52328762 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 52315561 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 59 (D59G)

Ref Sequence

ENSEMBL: ENSMUSP00000056401 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058326] [ENSMUST00000135523]

AlphaFold

Q9QX96

Predicted Effect

possibly damaging
Transcript: ENSMUST00000058326
AA Change: D59G

PolyPhen 2 Score 0.635 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000056401
Gene: ENSMUSG00000049532
AA Change: D59G

Domain	Start	End	E-Value	Type
low complexity region	71	81	N/A	INTRINSIC
low complexity region	97	110	N/A	INTRINSIC
low complexity region	128	139	N/A	INTRINSIC
low complexity region	151	170	N/A	INTRINSIC
ZnF_C2H2	372	394	2.57e-3	SMART
ZnF_C2H2	400	422	1.28e-3	SMART
low complexity region	476	501	N/A	INTRINSIC
low complexity region	602	627	N/A	INTRINSIC
ZnF_C2H2	629	651	1.2e1	SMART
ZnF_C2H2	657	679	1.69e-3	SMART
ZnF_C2H2	689	711	6.88e-4	SMART
low complexity region	719	730	N/A	INTRINSIC
low complexity region	747	779	N/A	INTRINSIC
low complexity region	799	819	N/A	INTRINSIC
low complexity region	829	848	N/A	INTRINSIC
ZnF_C2H2	908	930	2.09e-3	SMART
ZnF_C2H2	937	960	1.01e-1	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000135523
AA Change: D57G

PolyPhen 2 Score 0.750 (Sensitivity: 0.85; Specificity: 0.92)

Meta Mutation Damage Score

0.0857

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple zinc finger domains. The encoded protein functions in optical fissure closure during development of the eye in the embryo. Mutations in this gene are associated with ocular coloboma. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in no apparent abnormal phenotypes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrg7	T	C	16: 56,732,857	I626V	probably benign	Het
Adgrv1	A	T	13: 81,440,225	V4414E	possibly damaging	Het
Ago1	C	T	4: 126,461,752	R88H	probably benign	Het
Ankrd6	C	T	4: 32,810,299	D461N	probably damaging	Het
Bcl2l14	A	G	6: 134,427,454	N202D	probably benign	Het
Bnip2	A	G	9: 70,003,404	I245V	probably damaging	Het
Cdhr3	T	C	12: 33,060,265	D340G	probably damaging	Het
Dchs1	T	C	7: 105,761,859	E1653G	probably damaging	Het
Dhdds	C	A	4: 133,971,254	Q256H	possibly damaging	Het
Dsc2	A	T	18: 20,035,394	C669*	probably null	Het
Dync2h1	T	C	9: 7,135,015		probably null	Het
Dysf	T	C	6: 84,067,478	S276P	probably benign	Het
Galc	A	T	12: 98,259,238	L31*	probably null	Het
Gm527	C	T	12: 64,922,410	R204C	possibly damaging	Het
Hivep3	G	A	4: 120,132,402	D2017N	probably benign	Het
Inf2	C	T	12: 112,600,318	R106C	probably damaging	Het
Itgb1	A	G	8: 128,720,305	K434E	probably benign	Het
Lamb1	A	C	12: 31,300,021	N700T	probably benign	Het
Macc1	T	G	12: 119,446,999	F501V	possibly damaging	Het
Man2a2	G	A	7: 80,352,997	H1079Y	probably damaging	Het
Nedd4l	G	A	18: 65,080,018	V82I	possibly damaging	Het
Nr2f1	T	C	13: 78,195,242	E301G	probably damaging	Het
Olfr1129	A	G	2: 87,575,371	R96G	probably damaging	Het
Olfr1246	T	C	2: 89,590,696	I140V	probably benign	Het
Olfr695	A	G	7: 106,714,228	L151P	probably benign	Het
Pdgfrb	G	A	18: 61,078,932	V844I	possibly damaging	Het
Pkd1l2	T	C	8: 117,060,594	E570G	possibly damaging	Het
R3hdm4	A	T	10: 79,916,874	L4Q	probably damaging	Het
Rb1cc1	A	G	1: 6,248,191	K639R	probably null	Het
Robo3	A	T	9: 37,427,825	C257S	probably damaging	Het
Rprd2	A	T	3: 95,765,775	L772Q	probably damaging	Het
Sall3	T	C	18: 80,973,364	T450A	probably benign	Het
Sdhd	T	C	9: 50,597,085	*160W	probably null	Het
Sgca	T	C	11: 94,971,244	E194G	possibly damaging	Het
Shtn1	G	A	19: 59,028,184	R228C	probably damaging	Het
Skor1	A	T	9: 63,146,850	S22T	probably benign	Het
Slc26a8	C	A	17: 28,644,850	G645V	probably benign	Het
Smtn	T	C	11: 3,529,988	E411G	probably damaging	Het
Sox17	A	G	1: 4,492,327	Y217H	probably damaging	Het
Syk	A	G	13: 52,612,416	Q179R	probably benign	Het
Tpp2	A	G	1: 43,983,517	I959M	probably benign	Het
Trim65	T	A	11: 116,126,316	N440I	probably damaging	Het
Ubr2	C	T	17: 46,990,991		probably null	Het
Ush2a	T	C	1: 188,351,087	S276P	possibly damaging	Het
Vmn1r61	A	G	7: 5,610,431	S295P	probably benign	Het
Wdhd1	T	C	14: 47,274,024	Q77R	probably benign	Het
Xylb	T	A	9: 119,391,816	*552R	probably null	Het
Zfp932	C	T	5: 110,008,828	P131S	probably damaging	Het

Other mutations in Sall2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01587:Sall2	APN	14	52314571	missense	probably damaging	1.00
IGL02152:Sall2	APN	14	52315514	missense	probably damaging	1.00
IGL02318:Sall2	APN	14	52315565	missense	probably damaging	1.00
IGL02933:Sall2	APN	14	52313027	missense	probably benign	0.00
IGL03165:Sall2	APN	14	52314168	missense	probably damaging	1.00
R1079:Sall2	UTSW	14	52313203	missense	probably benign	0.13
R1295:Sall2	UTSW	14	52313725	missense	probably damaging	1.00
R1674:Sall2	UTSW	14	52313836	missense	probably damaging	1.00
R1840:Sall2	UTSW	14	52313725	missense	probably damaging	1.00
R1989:Sall2	UTSW	14	52314439	missense	probably damaging	1.00
R2339:Sall2	UTSW	14	52313356	missense	probably damaging	1.00
R3407:Sall2	UTSW	14	52328104	missense	probably benign	0.03
R3870:Sall2	UTSW	14	52313994	missense	probably damaging	1.00
R3895:Sall2	UTSW	14	52314047	missense	probably damaging	0.99
R4059:Sall2	UTSW	14	52314571	missense	probably damaging	1.00
R4272:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4273:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4275:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4289:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4503:Sall2	UTSW	14	52313459	missense	probably benign
R4592:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4611:Sall2	UTSW	14	52313753	missense	probably damaging	1.00
R4615:Sall2	UTSW	14	52312750	missense	probably benign	0.20
R4640:Sall2	UTSW	14	52315159	missense	probably damaging	0.99
R4693:Sall2	UTSW	14	52314478	missense	probably damaging	1.00
R4921:Sall2	UTSW	14	52315393	missense	possibly damaging	0.93
R5007:Sall2	UTSW	14	52314493	missense	probably damaging	1.00
R5015:Sall2	UTSW	14	52315655	missense	possibly damaging	0.92
R5079:Sall2	UTSW	14	52314754	missense	probably damaging	1.00
R5419:Sall2	UTSW	14	52313129	missense	probably damaging	1.00
R5849:Sall2	UTSW	14	52314247	missense	probably benign	0.13
R6229:Sall2	UTSW	14	52313191	missense	probably benign
R6397:Sall2	UTSW	14	52315153	missense	probably damaging	1.00
R6422:Sall2	UTSW	14	52312724	makesense	probably null
R6456:Sall2	UTSW	14	52313593	missense	probably damaging	1.00
R6456:Sall2	UTSW	14	52313594	nonsense	probably null
R6786:Sall2	UTSW	14	52314621	missense	probably damaging	1.00
R7293:Sall2	UTSW	14	52314411	nonsense	probably null
R7792:Sall2	UTSW	14	52316064	missense	probably damaging	1.00
R8324:Sall2	UTSW	14	52312886	missense	probably benign	0.30
R9017:Sall2	UTSW	14	52313262	missense	possibly damaging	0.51
R9149:Sall2	UTSW	14	52313216	missense	possibly damaging	0.95
R9362:Sall2	UTSW	14	52313144	nonsense	probably null
R9571:Sall2	UTSW	14	52314373	missense	probably damaging	1.00
R9574:Sall2	UTSW	14	52314160	missense	probably damaging	1.00
R9641:Sall2	UTSW	14	52313425	missense	probably damaging	1.00
R9648:Sall2	UTSW	14	52313767	missense	probably damaging	1.00
R9694:Sall2	UTSW	14	52314667	missense	possibly damaging	0.63

Predicted Primers

PCR Primer
(F):5'- GAATTGCCCAGAAGATTCCTCTC -3'
(R):5'- TTAAATTCCGACCCTAACCGG -3'

Sequencing Primer
(F):5'- AGAAGATTCCTCTCCCCTCCG -3'
(R):5'- CGGAGGTTCCTGGGCCG -3'

Posted On

2019-10-17