Mutagenetix > Incidental Mutation

Incidental Mutation 'R7496:Nedd4l'

581102

Institutional Source

Beutler Lab

Gene Symbol

Nedd4l

Ensembl Gene

ENSMUSG00000024589

Gene Name

neural precursor cell expressed, developmentally down-regulated gene 4-like

Synonyms

Nedd4-2, Nedd4b, 1300012C07Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.245) question?

Stock #

R7496 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

64887705-65217831 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 65080018 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 82 (V82I)

Ref Sequence

ENSEMBL: ENSMUSP00000132838 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080418] [ENSMUST00000163516] [ENSMUST00000224347] [ENSMUST00000224385] [ENSMUST00000225057] [ENSMUST00000225261] [ENSMUST00000226058]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000080418

SMART Domains

Protein: ENSMUSP00000079280
Gene: ENSMUSG00000024589

Domain	Start	End	E-Value	Type
PDB:3M7F\|B	1	64	2e-21	PDB
WW	73	105	2.32e-13	SMART
low complexity region	139	154	N/A	INTRINSIC
low complexity region	166	178	N/A	INTRINSIC
low complexity region	234	247	N/A	INTRINSIC
WW	266	298	2.08e-15	SMART
low complexity region	355	371	N/A	INTRINSIC
WW	378	410	4.1e-14	SMART
WW	429	461	1.53e-13	SMART
HECTc	518	854	3.04e-183	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000163516
AA Change: V82I

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000132838
Gene: ENSMUSG00000024589
AA Change: V82I

Domain	Start	End	E-Value	Type
C2	21	124	1.76e-25	SMART
WW	194	226	2.32e-13	SMART
low complexity region	260	275	N/A	INTRINSIC
low complexity region	287	299	N/A	INTRINSIC
low complexity region	355	368	N/A	INTRINSIC
WW	387	419	2.08e-15	SMART
low complexity region	476	492	N/A	INTRINSIC
WW	499	531	4.1e-14	SMART
WW	550	582	1.53e-13	SMART
HECTc	639	975	3.04e-183	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000224347

Predicted Effect

probably benign
Transcript: ENSMUST00000224385

Predicted Effect

probably damaging
Transcript: ENSMUST00000225057
AA Change: V82I

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

Predicted Effect

probably benign
Transcript: ENSMUST00000225261

Predicted Effect

probably benign
Transcript: ENSMUST00000226058

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of HECT domain E3 ubiquitin ligases. HECT domain E3 ubiquitin ligases transfer ubiquitin from E2 ubiquitin-conjugating enzymes to protein substrates, thus targeting specific proteins for lysosomal degradation. The encoded protein mediates the ubiquitination of multiple target substrates and plays a critical role in epithelial sodium transport by regulating the cell surface expression of the epithelial sodium channel, ENaC. Single nucleotide polymorphisms in this gene may be associated with essential hypertension. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a null mutation display salt sensitive hypertension and high salt diet induced cardiac hypertrophy. A spontaneous mutation results in overt diabetes insipidus. Mice homozygous for a knock-out allele exhibit neonatal lethality with primary atelectasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrg7	T	C	16: 56,732,857	I626V	probably benign	Het
Adgrv1	A	T	13: 81,440,225	V4414E	possibly damaging	Het
Ago1	C	T	4: 126,461,752	R88H	probably benign	Het
Ankrd6	C	T	4: 32,810,299	D461N	probably damaging	Het
Bcl2l14	A	G	6: 134,427,454	N202D	probably benign	Het
Bnip2	A	G	9: 70,003,404	I245V	probably damaging	Het
Cdhr3	T	C	12: 33,060,265	D340G	probably damaging	Het
Dchs1	T	C	7: 105,761,859	E1653G	probably damaging	Het
Dhdds	C	A	4: 133,971,254	Q256H	possibly damaging	Het
Dsc2	A	T	18: 20,035,394	C669*	probably null	Het
Dync2h1	T	C	9: 7,135,015		probably null	Het
Dysf	T	C	6: 84,067,478	S276P	probably benign	Het
Galc	A	T	12: 98,259,238	L31*	probably null	Het
Gm527	C	T	12: 64,922,410	R204C	possibly damaging	Het
Hivep3	G	A	4: 120,132,402	D2017N	probably benign	Het
Inf2	C	T	12: 112,600,318	R106C	probably damaging	Het
Itgb1	A	G	8: 128,720,305	K434E	probably benign	Het
Lamb1	A	C	12: 31,300,021	N700T	probably benign	Het
Macc1	T	G	12: 119,446,999	F501V	possibly damaging	Het
Man2a2	G	A	7: 80,352,997	H1079Y	probably damaging	Het
Nr2f1	T	C	13: 78,195,242	E301G	probably damaging	Het
Olfr1129	A	G	2: 87,575,371	R96G	probably damaging	Het
Olfr1246	T	C	2: 89,590,696	I140V	probably benign	Het
Olfr695	A	G	7: 106,714,228	L151P	probably benign	Het
Pdgfrb	G	A	18: 61,078,932	V844I	possibly damaging	Het
Pkd1l2	T	C	8: 117,060,594	E570G	possibly damaging	Het
R3hdm4	A	T	10: 79,916,874	L4Q	probably damaging	Het
Rb1cc1	A	G	1: 6,248,191	K639R	probably null	Het
Robo3	A	T	9: 37,427,825	C257S	probably damaging	Het
Rprd2	A	T	3: 95,765,775	L772Q	probably damaging	Het
Sall2	T	C	14: 52,315,561	D59G	possibly damaging	Het
Sall3	T	C	18: 80,973,364	T450A	probably benign	Het
Sdhd	T	C	9: 50,597,085	*160W	probably null	Het
Sgca	T	C	11: 94,971,244	E194G	possibly damaging	Het
Shtn1	G	A	19: 59,028,184	R228C	probably damaging	Het
Skor1	A	T	9: 63,146,850	S22T	probably benign	Het
Slc26a8	C	A	17: 28,644,850	G645V	probably benign	Het
Smtn	T	C	11: 3,529,988	E411G	probably damaging	Het
Sox17	A	G	1: 4,492,327	Y217H	probably damaging	Het
Syk	A	G	13: 52,612,416	Q179R	probably benign	Het
Tpp2	A	G	1: 43,983,517	I959M	probably benign	Het
Trim65	T	A	11: 116,126,316	N440I	probably damaging	Het
Ubr2	C	T	17: 46,990,991		probably null	Het
Ush2a	T	C	1: 188,351,087	S276P	possibly damaging	Het
Vmn1r61	A	G	7: 5,610,431	S295P	probably benign	Het
Wdhd1	T	C	14: 47,274,024	Q77R	probably benign	Het
Xylb	T	A	9: 119,391,816	*552R	probably null	Het
Zfp932	C	T	5: 110,008,828	P131S	probably damaging	Het

Other mutations in Nedd4l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00501:Nedd4l	APN	18	65208092	missense	probably damaging	1.00
IGL00931:Nedd4l	APN	18	65172399	missense	possibly damaging	0.57
IGL02306:Nedd4l	APN	18	65172954	missense	possibly damaging	0.64
IGL02363:Nedd4l	APN	18	65208045	splice site	probably benign
IGL02440:Nedd4l	APN	18	65163173	critical splice donor site	probably null
IGL02444:Nedd4l	APN	18	65203957	splice site	probably benign
IGL02700:Nedd4l	APN	18	65209680	missense	probably damaging	1.00
IGL02943:Nedd4l	APN	18	65161652	critical splice donor site	probably null
IGL02999:Nedd4l	APN	18	65198707	missense	probably damaging	1.00
IGL03135:Nedd4l	APN	18	65205670	missense	probably damaging	1.00
IGL03373:Nedd4l	APN	18	65181320	splice site	probably benign
R0036:Nedd4l	UTSW	18	65051123	intron	probably benign
R0396:Nedd4l	UTSW	18	65161654	splice site	probably benign
R0472:Nedd4l	UTSW	18	65208461	missense	probably damaging	1.00
R0494:Nedd4l	UTSW	18	65173021	missense	possibly damaging	0.69
R0513:Nedd4l	UTSW	18	65195185	splice site	probably benign
R0609:Nedd4l	UTSW	18	65208461	missense	probably damaging	1.00
R0631:Nedd4l	UTSW	18	65208503	splice site	probably benign
R1077:Nedd4l	UTSW	18	65167499	splice site	probably benign
R1643:Nedd4l	UTSW	18	65198641	missense	probably damaging	1.00
R1722:Nedd4l	UTSW	18	65157939	missense	probably damaging	1.00
R1806:Nedd4l	UTSW	18	65212791	missense	probably damaging	1.00
R1921:Nedd4l	UTSW	18	65167575	critical splice donor site	probably null
R1986:Nedd4l	UTSW	18	65143803	missense	probably damaging	1.00
R2070:Nedd4l	UTSW	18	65212820	missense	probably damaging	1.00
R2151:Nedd4l	UTSW	18	65210330	missense	probably damaging	1.00
R2152:Nedd4l	UTSW	18	65210330	missense	probably damaging	1.00
R2154:Nedd4l	UTSW	18	65210330	missense	probably damaging	1.00
R2358:Nedd4l	UTSW	18	65209719	missense	possibly damaging	0.51
R2680:Nedd4l	UTSW	18	65163130	missense	possibly damaging	0.85
R3082:Nedd4l	UTSW	18	65178978	missense	probably benign	0.00
R3500:Nedd4l	UTSW	18	65212860	missense	probably damaging	1.00
R3711:Nedd4l	UTSW	18	65209719	missense	possibly damaging	0.51
R3712:Nedd4l	UTSW	18	65209719	missense	possibly damaging	0.51
R3874:Nedd4l	UTSW	18	65167535	missense	probably benign
R4435:Nedd4l	UTSW	18	65212825	missense	possibly damaging	0.84
R4698:Nedd4l	UTSW	18	65203880	missense	probably damaging	1.00
R4757:Nedd4l	UTSW	18	65165605	missense	probably damaging	0.98
R4783:Nedd4l	UTSW	18	65172927	missense	probably damaging	0.99
R4790:Nedd4l	UTSW	18	65203945	missense	possibly damaging	0.94
R4980:Nedd4l	UTSW	18	65080060	nonsense	probably null
R5106:Nedd4l	UTSW	18	65193305	missense	probably damaging	1.00
R5122:Nedd4l	UTSW	18	65191447	missense	probably damaging	1.00
R5605:Nedd4l	UTSW	18	65174244	critical splice donor site	probably null
R6465:Nedd4l	UTSW	18	65155264	missense	probably benign	0.06
R6479:Nedd4l	UTSW	18	65209681	missense	probably damaging	1.00
R6622:Nedd4l	UTSW	18	65174234	missense	probably damaging	0.99
R6773:Nedd4l	UTSW	18	65167551	missense	probably benign	0.36
R7065:Nedd4l	UTSW	18	65195969	missense	probably benign	0.04
R7068:Nedd4l	UTSW	18	65205651	missense	probably damaging	1.00
R7193:Nedd4l	UTSW	18	64997370	missense	probably damaging	1.00
R7903:Nedd4l	UTSW	18	65186367	missense	probably damaging	1.00
R8123:Nedd4l	UTSW	18	65074774	missense	probably damaging	1.00
R8185:Nedd4l	UTSW	18	65209698	missense	probably damaging	1.00
R8282:Nedd4l	UTSW	18	65191489	missense	probably damaging	0.98
R8440:Nedd4l	UTSW	18	64889055	splice site	probably null
R8499:Nedd4l	UTSW	18	65209657	missense	probably damaging	0.98
R8557:Nedd4l	UTSW	18	65203915	missense	probably benign	0.00
R8801:Nedd4l	UTSW	18	65155275	missense	probably damaging	1.00
R8896:Nedd4l	UTSW	18	65165617	missense	probably benign
R9025:Nedd4l	UTSW	18	65178924	missense	probably damaging	0.98
R9040:Nedd4l	UTSW	18	65209663	missense	probably damaging	0.99
R9482:Nedd4l	UTSW	18	64887960	unclassified	probably benign
R9498:Nedd4l	UTSW	18	65161652	critical splice donor site	probably null
R9599:Nedd4l	UTSW	18	65210329	missense	probably damaging	1.00
RF013:Nedd4l	UTSW	18	65209680	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAAGAGACCATGATACACGTATTG -3'
(R):5'- CTAGCAACACACAAATATTTGCTGG -3'

Sequencing Primer
(F):5'- ACCATGATACACGTATTGTCTTTTTC -3'
(R):5'- TGCTGGAACTGAGAACTTTAACAGTG -3'

Posted On

2019-10-17