Incidental Mutation 'R7496:Sall3'
ID581103
Institutional Source Beutler Lab
Gene Symbol Sall3
Ensembl Gene ENSMUSG00000024565
Gene Namespalt like transcription factor 3
SynonymsMsal, Spalt, Msal-1, Salt, B130022O04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7496 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location80966376-80986578 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80973364 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 450 (T450A)
Ref Sequence ENSEMBL: ENSMUSP00000056967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057950]
Predicted Effect probably benign
Transcript: ENSMUST00000057950
AA Change: T450A

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000056967
Gene: ENSMUSG00000024565
AA Change: T450A

DomainStartEndE-ValueType
low complexity region 34 51 N/A INTRINSIC
low complexity region 143 161 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
low complexity region 210 231 N/A INTRINSIC
low complexity region 271 289 N/A INTRINSIC
low complexity region 323 342 N/A INTRINSIC
low complexity region 350 371 N/A INTRINSIC
ZnF_C2H2 427 449 2.57e-3 SMART
ZnF_C2H2 455 477 3.21e-4 SMART
low complexity region 555 568 N/A INTRINSIC
ZnF_C2H2 692 714 3.99e0 SMART
ZnF_C2H2 720 742 2.99e-4 SMART
ZnF_C2H2 752 774 1.6e-4 SMART
low complexity region 834 852 N/A INTRINSIC
low complexity region 901 923 N/A INTRINSIC
low complexity region 993 1007 N/A INTRINSIC
ZnF_C2H2 1061 1083 1.69e-3 SMART
ZnF_C2H2 1089 1111 5.99e-4 SMART
Meta Mutation Damage Score 0.5882 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sal-like C2H2-type zinc-finger protein, and belongs to a family of evolutionarily conserved genes found in species as diverse as Drosophila, C. elegans, and vertebrates. Mutations in some of these genes are associated with congenital disorders in human, suggesting their importance in embryonic development. This protein binds to DNA methyltransferase 3 alpha (DNMT3A), and reduces DNMT3A-mediated CpG island methylation. It is suggested that silencing of this gene, resulting in acceleration of DNA methylation, may have a role in oncogenesis. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display neonatal lethality with an impaired suckling ability, truncated soft palate, small epiglottis, and abnormal cranial nerve morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 T C 16: 56,732,857 I626V probably benign Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Ago1 C T 4: 126,461,752 R88H probably benign Het
Ankrd6 C T 4: 32,810,299 D461N probably damaging Het
Bcl2l14 A G 6: 134,427,454 N202D probably benign Het
Bnip2 A G 9: 70,003,404 I245V probably damaging Het
Cdhr3 T C 12: 33,060,265 D340G probably damaging Het
Dchs1 T C 7: 105,761,859 E1653G probably damaging Het
Dhdds C A 4: 133,971,254 Q256H possibly damaging Het
Dsc2 A T 18: 20,035,394 C669* probably null Het
Dync2h1 T C 9: 7,135,015 probably null Het
Dysf T C 6: 84,067,478 S276P probably benign Het
Galc A T 12: 98,259,238 L31* probably null Het
Gm527 C T 12: 64,922,410 R204C possibly damaging Het
Hivep3 G A 4: 120,132,402 D2017N probably benign Het
Inf2 C T 12: 112,600,318 R106C probably damaging Het
Itgb1 A G 8: 128,720,305 K434E probably benign Het
Lamb1 A C 12: 31,300,021 N700T probably benign Het
Macc1 T G 12: 119,446,999 F501V possibly damaging Het
Man2a2 G A 7: 80,352,997 H1079Y probably damaging Het
Nedd4l G A 18: 65,080,018 V82I possibly damaging Het
Nr2f1 T C 13: 78,195,242 E301G probably damaging Het
Olfr1129 A G 2: 87,575,371 R96G probably damaging Het
Olfr1246 T C 2: 89,590,696 I140V probably benign Het
Olfr695 A G 7: 106,714,228 L151P probably benign Het
Pdgfrb G A 18: 61,078,932 V844I possibly damaging Het
Pkd1l2 T C 8: 117,060,594 E570G possibly damaging Het
R3hdm4 A T 10: 79,916,874 L4Q probably damaging Het
Rb1cc1 A G 1: 6,248,191 K639R probably null Het
Robo3 A T 9: 37,427,825 C257S probably damaging Het
Rprd2 A T 3: 95,765,775 L772Q probably damaging Het
Sall2 T C 14: 52,315,561 D59G possibly damaging Het
Sdhd T C 9: 50,597,085 *160W probably null Het
Sgca T C 11: 94,971,244 E194G possibly damaging Het
Shtn1 G A 19: 59,028,184 R228C probably damaging Het
Skor1 A T 9: 63,146,850 S22T probably benign Het
Slc26a8 C A 17: 28,644,850 G645V probably benign Het
Smtn T C 11: 3,529,988 E411G probably damaging Het
Sox17 A G 1: 4,492,327 Y217H probably damaging Het
Syk A G 13: 52,612,416 Q179R probably benign Het
Tpp2 A G 1: 43,983,517 I959M probably benign Het
Trim65 T A 11: 116,126,316 N440I probably damaging Het
Ubr2 C T 17: 46,990,991 probably null Het
Ush2a T C 1: 188,351,087 S276P possibly damaging Het
Vmn1r61 A G 7: 5,610,431 S295P probably benign Het
Wdhd1 T C 14: 47,274,024 Q77R probably benign Het
Xylb T A 9: 119,391,816 *552R probably null Het
Zfp932 C T 5: 110,008,828 P131S probably damaging Het
Other mutations in Sall3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Sall3 APN 18 80973232 missense probably damaging 0.98
IGL01630:Sall3 APN 18 80971269 missense probably benign 0.03
IGL01713:Sall3 APN 18 80969847 missense probably damaging 1.00
IGL01803:Sall3 APN 18 80969832 missense possibly damaging 0.65
IGL02627:Sall3 APN 18 80972361 missense possibly damaging 0.86
IGL02858:Sall3 APN 18 80969513 missense probably damaging 1.00
IGL03177:Sall3 APN 18 80972968 missense probably benign 0.00
fountain UTSW 18 80974476 missense probably damaging 0.99
IGL02984:Sall3 UTSW 18 80973450 missense probably benign 0.01
R1055:Sall3 UTSW 18 80969792 missense probably benign 0.24
R1258:Sall3 UTSW 18 80974065 missense probably damaging 1.00
R1932:Sall3 UTSW 18 80969753 missense probably benign 0.44
R1976:Sall3 UTSW 18 80971893 missense probably benign 0.42
R2124:Sall3 UTSW 18 80971797 missense probably benign 0.01
R2142:Sall3 UTSW 18 80969831 missense probably damaging 0.98
R2199:Sall3 UTSW 18 80971870 missense probably benign 0.27
R2365:Sall3 UTSW 18 80971792 missense probably benign 0.01
R3856:Sall3 UTSW 18 80972502 missense probably damaging 1.00
R4022:Sall3 UTSW 18 80969840 missense probably benign 0.05
R4050:Sall3 UTSW 18 80971482 missense probably benign 0.03
R4085:Sall3 UTSW 18 80972133 missense probably damaging 0.99
R4764:Sall3 UTSW 18 80974476 missense probably damaging 0.99
R4874:Sall3 UTSW 18 80973973 missense probably benign 0.33
R4948:Sall3 UTSW 18 80971411 missense probably benign 0.20
R5274:Sall3 UTSW 18 80969837 missense probably benign 0.15
R5602:Sall3 UTSW 18 80972812 missense probably benign
R6063:Sall3 UTSW 18 80974255 missense possibly damaging 0.52
R6256:Sall3 UTSW 18 80969861 missense possibly damaging 0.74
R6431:Sall3 UTSW 18 80973187 missense possibly damaging 0.94
R6523:Sall3 UTSW 18 80973188 missense possibly damaging 0.68
R6719:Sall3 UTSW 18 80971506 missense probably damaging 0.99
R6861:Sall3 UTSW 18 80974375 nonsense probably null
R7078:Sall3 UTSW 18 80974099 missense probably damaging 0.97
R7107:Sall3 UTSW 18 80973754 missense probably benign 0.01
R7108:Sall3 UTSW 18 80973754 missense probably benign 0.01
R7453:Sall3 UTSW 18 80972040 missense probably benign 0.07
R7491:Sall3 UTSW 18 80972705 missense probably benign 0.03
R7584:Sall3 UTSW 18 80974530 missense probably benign 0.00
R7599:Sall3 UTSW 18 80972052 missense possibly damaging 0.56
R7809:Sall3 UTSW 18 80974360 missense probably benign 0.00
R8244:Sall3 UTSW 18 80973754 missense probably benign 0.01
R8245:Sall3 UTSW 18 80973754 missense probably benign 0.01
R8250:Sall3 UTSW 18 80973528 missense probably benign 0.01
R8335:Sall3 UTSW 18 80969586 missense probably benign 0.35
R8360:Sall3 UTSW 18 80974017 missense probably benign 0.31
R8410:Sall3 UTSW 18 80973754 missense probably benign 0.01
R8476:Sall3 UTSW 18 80972118 nonsense probably null
R8712:Sall3 UTSW 18 80974021 missense not run
R8726:Sall3 UTSW 18 80986493 missense possibly damaging 0.89
Z1176:Sall3 UTSW 18 80972760 missense probably benign 0.19
Z1177:Sall3 UTSW 18 80974276 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ATGTTGGTACAGTGGGCAGC -3'
(R):5'- AGCAGTGTCATCTTCCCCAAC -3'

Sequencing Primer
(F):5'- CACTGGCTTGCTGTCCAG -3'
(R):5'- ATTGCTGCCACCGCCAATG -3'
Posted On2019-10-17