Incidental Mutation 'R7496:Shtn1'
ID581104
Institutional Source Beutler Lab
Gene Symbol Shtn1
Ensembl Gene ENSMUSG00000041362
Gene Nameshootin 1
Synonyms4930506M07Rik, shootin1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7496 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location58973358-59076069 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 59028184 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 228 (R228C)
Ref Sequence ENSEMBL: ENSMUSP00000041378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047511] [ENSMUST00000163821]
Predicted Effect probably damaging
Transcript: ENSMUST00000047511
AA Change: R228C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041378
Gene: ENSMUSG00000041362
AA Change: R228C

DomainStartEndE-ValueType
coiled coil region 7 59 N/A INTRINSIC
low complexity region 120 132 N/A INTRINSIC
coiled coil region 137 233 N/A INTRINSIC
coiled coil region 259 353 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163821
AA Change: R228C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126227
Gene: ENSMUSG00000041362
AA Change: R228C

DomainStartEndE-ValueType
internal_repeat_1 59 77 1.42e-6 PROSPERO
low complexity region 120 132 N/A INTRINSIC
internal_repeat_1 207 225 1.42e-6 PROSPERO
coiled coil region 259 353 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 T C 16: 56,732,857 I626V probably benign Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Ago1 C T 4: 126,461,752 R88H probably benign Het
Ankrd6 C T 4: 32,810,299 D461N probably damaging Het
Bcl2l14 A G 6: 134,427,454 N202D probably benign Het
Bnip2 A G 9: 70,003,404 I245V probably damaging Het
Cdhr3 T C 12: 33,060,265 D340G probably damaging Het
Dchs1 T C 7: 105,761,859 E1653G probably damaging Het
Dhdds C A 4: 133,971,254 Q256H possibly damaging Het
Dsc2 A T 18: 20,035,394 C669* probably null Het
Dync2h1 T C 9: 7,135,015 probably null Het
Dysf T C 6: 84,067,478 S276P probably benign Het
Galc A T 12: 98,259,238 L31* probably null Het
Gm527 C T 12: 64,922,410 R204C possibly damaging Het
Hivep3 G A 4: 120,132,402 D2017N probably benign Het
Inf2 C T 12: 112,600,318 R106C probably damaging Het
Itgb1 A G 8: 128,720,305 K434E probably benign Het
Lamb1 A C 12: 31,300,021 N700T probably benign Het
Macc1 T G 12: 119,446,999 F501V possibly damaging Het
Man2a2 G A 7: 80,352,997 H1079Y probably damaging Het
Nedd4l G A 18: 65,080,018 V82I possibly damaging Het
Nr2f1 T C 13: 78,195,242 E301G probably damaging Het
Olfr1129 A G 2: 87,575,371 R96G probably damaging Het
Olfr1246 T C 2: 89,590,696 I140V probably benign Het
Olfr695 A G 7: 106,714,228 L151P probably benign Het
Pdgfrb G A 18: 61,078,932 V844I possibly damaging Het
Pkd1l2 T C 8: 117,060,594 E570G possibly damaging Het
R3hdm4 A T 10: 79,916,874 L4Q probably damaging Het
Rb1cc1 A G 1: 6,248,191 K639R probably null Het
Robo3 A T 9: 37,427,825 C257S probably damaging Het
Rprd2 A T 3: 95,765,775 L772Q probably damaging Het
Sall2 T C 14: 52,315,561 D59G possibly damaging Het
Sall3 T C 18: 80,973,364 T450A probably benign Het
Sdhd T C 9: 50,597,085 *160W probably null Het
Sgca T C 11: 94,971,244 E194G possibly damaging Het
Skor1 A T 9: 63,146,850 S22T probably benign Het
Slc26a8 C A 17: 28,644,850 G645V probably benign Het
Smtn T C 11: 3,529,988 E411G probably damaging Het
Sox17 A G 1: 4,492,327 Y217H probably damaging Het
Syk A G 13: 52,612,416 Q179R probably benign Het
Tpp2 A G 1: 43,983,517 I959M probably benign Het
Trim65 T A 11: 116,126,316 N440I probably damaging Het
Ubr2 C T 17: 46,990,991 probably null Het
Ush2a T C 1: 188,351,087 S276P possibly damaging Het
Vmn1r61 A G 7: 5,610,431 S295P probably benign Het
Wdhd1 T C 14: 47,274,024 Q77R probably benign Het
Xylb T A 9: 119,391,816 *552R probably null Het
Zfp932 C T 5: 110,008,828 P131S probably damaging Het
Other mutations in Shtn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00945:Shtn1 APN 19 59018952 missense possibly damaging 0.56
IGL01619:Shtn1 APN 19 59028169 missense probably damaging 0.99
IGL01880:Shtn1 APN 19 59075449 splice site probably benign
IGL02214:Shtn1 APN 19 58999886 splice site probably benign
IGL03400:Shtn1 APN 19 59032258 splice site probably benign
R0011:Shtn1 UTSW 19 59032218 missense possibly damaging 0.72
R0011:Shtn1 UTSW 19 59032218 missense possibly damaging 0.72
R0299:Shtn1 UTSW 19 59018951 missense probably benign 0.00
R0606:Shtn1 UTSW 19 58999940 missense probably damaging 0.99
R1081:Shtn1 UTSW 19 58975015 missense probably benign 0.04
R1212:Shtn1 UTSW 19 59050890 missense probably damaging 1.00
R1677:Shtn1 UTSW 19 59009790 missense probably damaging 1.00
R1791:Shtn1 UTSW 19 59032200 missense probably damaging 0.99
R1966:Shtn1 UTSW 19 58975038 missense probably benign
R3076:Shtn1 UTSW 19 58995086 missense probably damaging 1.00
R3552:Shtn1 UTSW 19 58975038 missense probably benign 0.28
R3736:Shtn1 UTSW 19 59022268 missense probably benign
R4615:Shtn1 UTSW 19 59022216 missense probably benign 0.18
R4789:Shtn1 UTSW 19 59050873 missense probably damaging 0.99
R4791:Shtn1 UTSW 19 59050873 missense probably damaging 0.99
R4792:Shtn1 UTSW 19 59050873 missense probably damaging 0.99
R4939:Shtn1 UTSW 19 59022201 missense probably benign 0.00
R5245:Shtn1 UTSW 19 59032220 missense possibly damaging 0.90
R5387:Shtn1 UTSW 19 59038369 missense probably damaging 1.00
R5813:Shtn1 UTSW 19 59032241 missense probably damaging 1.00
R6013:Shtn1 UTSW 19 58975101 missense probably damaging 1.00
R6374:Shtn1 UTSW 19 59038296 missense possibly damaging 0.94
R7030:Shtn1 UTSW 19 59009834 missense possibly damaging 0.74
R7143:Shtn1 UTSW 19 59018906 missense probably damaging 0.99
R7487:Shtn1 UTSW 19 59003860 missense probably damaging 0.99
R7889:Shtn1 UTSW 19 59003896 missense probably damaging 0.99
R8209:Shtn1 UTSW 19 59003896 missense possibly damaging 0.86
R8226:Shtn1 UTSW 19 59003896 missense possibly damaging 0.86
R8290:Shtn1 UTSW 19 58999894 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTCATGACGCAGCAGCTC -3'
(R):5'- GCTAAGCTACCCTTCATAAAGCTC -3'

Sequencing Primer
(F):5'- TCAGTTGACACCTAACAGCTGTG -3'
(R):5'- TACCCTTCATAAAGCTCACCACTC -3'
Posted On2019-10-17