Incidental Mutation 'R7497:Snx5'
ID581113
Institutional Source Beutler Lab
Gene Symbol Snx5
Ensembl Gene ENSMUSG00000027423
Gene Namesorting nexin 5
SynonymsD2Ertd52e, 0910001N05Rik, 1810032P22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.277) question?
Stock #R7497 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location144250123-144270906 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 144257974 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 137 (K137E)
Ref Sequence ENSEMBL: ENSMUSP00000028909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028909] [ENSMUST00000110030]
Predicted Effect probably damaging
Transcript: ENSMUST00000028909
AA Change: K137E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000028909
Gene: ENSMUSG00000027423
AA Change: K137E

DomainStartEndE-ValueType
PX 31 169 1.85e-2 SMART
Pfam:Vps5 179 398 6.3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110030
AA Change: K137E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105657
Gene: ENSMUSG00000027423
AA Change: K137E

DomainStartEndE-ValueType
PX 31 169 1.85e-2 SMART
Pfam:Vps5 179 398 1.7e-19 PFAM
Meta Mutation Damage Score 0.7804 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein functions in endosomal sorting, the phosphoinositide-signaling pathway, and macropinocytosis. This gene may play a role in the tumorigenesis of papillary thyroid carcinoma. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit impaired alveolar epithelial differentiation of type I cells, respiratory failure and lethality during the perinatal and postnatal periods. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 T A 15: 91,191,176 I145F probably benign Het
Acvr2b T A 9: 119,433,286 V455E probably benign Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Agap2 T C 10: 127,090,965 V977A probably damaging Het
Als2cr12 T A 1: 58,678,308 D148V probably damaging Het
Aph1b A C 9: 66,794,119 S79A probably damaging Het
Atm G A 9: 53,511,891 S645L probably benign Het
Ccdc173 A C 2: 69,758,448 N439K probably benign Het
Cdh11 T C 8: 102,673,824 R171G probably benign Het
Ces2f T A 8: 104,954,698 D556E probably benign Het
Cyp26b1 C A 6: 84,576,982 V218L possibly damaging Het
D11Wsu47e T A 11: 113,692,397 W517R probably damaging Het
Diaph1 T C 18: 37,895,300 probably null Het
Dock1 A G 7: 134,765,274 I482V probably benign Het
Dok4 A T 8: 94,867,425 D47E possibly damaging Het
Dqx1 T A 6: 83,059,047 L120Q probably damaging Het
Duxf3 A T 10: 58,230,736 V157E probably damaging Het
Eif2a C A 3: 58,548,681 P367Q probably damaging Het
Elp2 C T 18: 24,611,928 R102C probably damaging Het
Erich2 T C 2: 70,534,322 S347P probably damaging Het
Fgfr3 GGACCTCTCCGTG GG 5: 33,735,422 probably null Het
Gadl1 A T 9: 116,074,087 I495L probably benign Het
Gcnt4 A G 13: 96,946,960 T255A possibly damaging Het
Gm10972 A G 3: 94,643,580 K21E unknown Het
Gm11639 T C 11: 104,762,690 probably null Het
Gm7361 C A 5: 26,261,190 H183Q probably benign Het
Gp2 C T 7: 119,454,606 C44Y probably damaging Het
Hcar2 C T 5: 123,865,186 V85I probably benign Het
Hira T C 16: 18,952,079 V822A probably damaging Het
Ighv1-5 T A 12: 114,513,536 T49S probably damaging Het
Ints1 C T 5: 139,768,976 V603M probably damaging Het
Kdm2a A C 19: 4,324,376 L909R probably damaging Het
Klkb1 T A 8: 45,294,790 probably benign Het
Krit1 A G 5: 3,812,349 H168R possibly damaging Het
Map3k21 A T 8: 125,927,601 E386D probably damaging Het
Muc16 C T 9: 18,645,089 E3303K unknown Het
Muc5b T G 7: 141,861,513 V2732G possibly damaging Het
Myo5a T C 9: 75,197,701 L189P Het
Nlrc5 T C 8: 94,521,970 L1740S probably damaging Het
Nolc1 A G 19: 46,082,818 K402R probably benign Het
Olfr1272 T A 2: 90,281,754 T274S possibly damaging Het
Olfr52 T C 2: 86,182,073 I13V probably benign Het
Olfr601 T C 7: 103,359,012 M61V probably damaging Het
Olfr727 T A 14: 50,127,495 L306Q probably benign Het
Pnmal2 A G 7: 16,944,949 probably benign Het
Pnpt1 A T 11: 29,130,860 M35L probably benign Het
Postn A G 3: 54,362,670 K57E probably damaging Het
Ppp1r9a A C 6: 4,905,775 D110A probably damaging Het
Pptc7 G A 5: 122,284,879 V71M possibly damaging Het
Prdm11 T A 2: 93,012,707 I136F possibly damaging Het
Rfc1 A G 5: 65,279,498 L613P probably damaging Het
Ryr3 T C 2: 112,730,473 D2981G probably benign Het
Sbf2 C A 7: 110,614,716 E16* probably null Het
Scara3 T C 14: 65,931,202 E322G probably damaging Het
Sema5b T A 16: 35,661,330 C893S probably damaging Het
Setdb1 T C 3: 95,341,828 D323G probably damaging Het
Slc19a3 T C 1: 83,013,928 Y453C probably damaging Het
Taar8c G A 10: 24,101,218 T232I probably benign Het
Taok2 G A 7: 126,874,878 T352I probably damaging Het
Ttc3 C A 16: 94,418,682 R489S possibly damaging Het
Usp12 A T 5: 146,752,454 probably null Het
Usp16 T A 16: 87,466,286 C125* probably null Het
Vmn2r106 C T 17: 20,267,939 E733K probably damaging Het
Vps13b T A 15: 35,876,697 I2832K probably benign Het
Vps13c A G 9: 67,840,479 Y18C probably damaging Het
Zfp160 T A 17: 21,026,193 I335K probably benign Het
Zfp788 A T 7: 41,648,851 I304F possibly damaging Het
Other mutations in Snx5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Snx5 APN 2 144255565 missense probably benign
IGL01739:Snx5 APN 2 144270405 missense probably benign 0.00
IGL03394:Snx5 APN 2 144253754 missense probably damaging 1.00
R0052:Snx5 UTSW 2 144259192 splice site probably null
R0052:Snx5 UTSW 2 144259192 splice site probably null
R0344:Snx5 UTSW 2 144257208 splice site probably benign
R0848:Snx5 UTSW 2 144253806 missense probably damaging 0.98
R1440:Snx5 UTSW 2 144254811 missense possibly damaging 0.90
R2282:Snx5 UTSW 2 144253675 missense probably benign 0.03
R3830:Snx5 UTSW 2 144254901 critical splice donor site probably null
R5727:Snx5 UTSW 2 144260754 missense probably benign 0.00
R6048:Snx5 UTSW 2 144259153 missense probably damaging 0.97
R7664:Snx5 UTSW 2 144258004 splice site probably null
R7895:Snx5 UTSW 2 144253820 missense possibly damaging 0.90
R8098:Snx5 UTSW 2 144255562 missense probably benign 0.00
Z1088:Snx5 UTSW 2 144252491 missense probably benign 0.29
Z1177:Snx5 UTSW 2 144259079 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGAAGTCAGGGCTTGCTTC -3'
(R):5'- CTCAGGCTTTCAGTTATAGTGGC -3'

Sequencing Primer
(F):5'- CAGGGCTTGCTTCATATATGAAAAGG -3'
(R):5'- TCATTGGTTCATTCCACAGTTAAC -3'
Posted On2019-10-17