Incidental Mutation 'R7497:Cdh11'
ID581141
Institutional Source Beutler Lab
Gene Symbol Cdh11
Ensembl Gene ENSMUSG00000031673
Gene Namecadherin 11
Synonymsosteoblast-cadherin, Cad11, OB-cadherin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7497 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location102632095-102785642 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102673824 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 171 (R171G)
Ref Sequence ENSEMBL: ENSMUSP00000074681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075190]
PDB Structure
Crystal structure of mouse cadherin-11 EC1 [X-RAY DIFFRACTION]
Crystal structure of mouse cadherin-11 EC1-2 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000075190
AA Change: R171G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000074681
Gene: ENSMUSG00000031673
AA Change: R171G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 76 157 1.99e-19 SMART
CA 181 266 3.33e-30 SMART
CA 290 382 3.37e-17 SMART
CA 405 486 1.14e-23 SMART
CA 513 600 4.77e-8 SMART
transmembrane domain 618 640 N/A INTRINSIC
Pfam:Cadherin_C 643 788 1.1e-56 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: This gene encodes a type II classical cadherin and preproprotein that is proteolytically processed to generate a mature protein product. This protein product is an integral membrane protein that mediates calcium-dependent cell-cell adhesion, specifically in the context of bone development. Homozygous knockout mice for this gene exhibit impaired synovium development and reduced bone density. Multiple pseudogenes of this gene have been identified in the genome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous mutant animals appear healthy and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 T A 15: 91,191,176 I145F probably benign Het
Acvr2b T A 9: 119,433,286 V455E probably benign Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Agap2 T C 10: 127,090,965 V977A probably damaging Het
Als2cr12 T A 1: 58,678,308 D148V probably damaging Het
Aph1b A C 9: 66,794,119 S79A probably damaging Het
Atm G A 9: 53,511,891 S645L probably benign Het
Ccdc173 A C 2: 69,758,448 N439K probably benign Het
Ces2f T A 8: 104,954,698 D556E probably benign Het
Cyp26b1 C A 6: 84,576,982 V218L possibly damaging Het
D11Wsu47e T A 11: 113,692,397 W517R probably damaging Het
Diaph1 T C 18: 37,895,300 probably null Het
Dock1 A G 7: 134,765,274 I482V probably benign Het
Dok4 A T 8: 94,867,425 D47E possibly damaging Het
Dqx1 T A 6: 83,059,047 L120Q probably damaging Het
Duxf3 A T 10: 58,230,736 V157E probably damaging Het
Eif2a C A 3: 58,548,681 P367Q probably damaging Het
Elp2 C T 18: 24,611,928 R102C probably damaging Het
Erich2 T C 2: 70,534,322 S347P probably damaging Het
Fgfr3 GGACCTCTCCGTG GG 5: 33,735,422 probably null Het
Gadl1 A T 9: 116,074,087 I495L probably benign Het
Gcnt4 A G 13: 96,946,960 T255A possibly damaging Het
Gm10972 A G 3: 94,643,580 K21E unknown Het
Gm11639 T C 11: 104,762,690 probably null Het
Gm7361 C A 5: 26,261,190 H183Q probably benign Het
Gp2 C T 7: 119,454,606 C44Y probably damaging Het
Hcar2 C T 5: 123,865,186 V85I probably benign Het
Hira T C 16: 18,952,079 V822A probably damaging Het
Ighv1-5 T A 12: 114,513,536 T49S probably damaging Het
Ints1 C T 5: 139,768,976 V603M probably damaging Het
Kdm2a A C 19: 4,324,376 L909R probably damaging Het
Klkb1 T A 8: 45,294,790 probably benign Het
Krit1 A G 5: 3,812,349 H168R possibly damaging Het
Map3k21 A T 8: 125,927,601 E386D probably damaging Het
Muc16 C T 9: 18,645,089 E3303K unknown Het
Muc5b T G 7: 141,861,513 V2732G possibly damaging Het
Myo5a T C 9: 75,197,701 L189P Het
Nlrc5 T C 8: 94,521,970 L1740S probably damaging Het
Nolc1 A G 19: 46,082,818 K402R probably benign Het
Olfr1272 T A 2: 90,281,754 T274S possibly damaging Het
Olfr52 T C 2: 86,182,073 I13V probably benign Het
Olfr601 T C 7: 103,359,012 M61V probably damaging Het
Olfr727 T A 14: 50,127,495 L306Q probably benign Het
Pnmal2 A G 7: 16,944,949 probably benign Het
Pnpt1 A T 11: 29,130,860 M35L probably benign Het
Postn A G 3: 54,362,670 K57E probably damaging Het
Ppp1r9a A C 6: 4,905,775 D110A probably damaging Het
Pptc7 G A 5: 122,284,879 V71M possibly damaging Het
Prdm11 T A 2: 93,012,707 I136F possibly damaging Het
Rfc1 A G 5: 65,279,498 L613P probably damaging Het
Ryr3 T C 2: 112,730,473 D2981G probably benign Het
Sbf2 C A 7: 110,614,716 E16* probably null Het
Scara3 T C 14: 65,931,202 E322G probably damaging Het
Sema5b T A 16: 35,661,330 C893S probably damaging Het
Setdb1 T C 3: 95,341,828 D323G probably damaging Het
Slc19a3 T C 1: 83,013,928 Y453C probably damaging Het
Snx5 T C 2: 144,257,974 K137E probably damaging Het
Taar8c G A 10: 24,101,218 T232I probably benign Het
Taok2 G A 7: 126,874,878 T352I probably damaging Het
Ttc3 C A 16: 94,418,682 R489S possibly damaging Het
Usp12 A T 5: 146,752,454 probably null Het
Usp16 T A 16: 87,466,286 C125* probably null Het
Vmn2r106 C T 17: 20,267,939 E733K probably damaging Het
Vps13b T A 15: 35,876,697 I2832K probably benign Het
Vps13c A G 9: 67,840,479 Y18C probably damaging Het
Zfp160 T A 17: 21,026,193 I335K probably benign Het
Zfp788 A T 7: 41,648,851 I304F possibly damaging Het
Other mutations in Cdh11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00598:Cdh11 APN 8 102650649 missense probably damaging 1.00
IGL01019:Cdh11 APN 8 102679745 missense probably benign
IGL01286:Cdh11 APN 8 102664629 missense probably damaging 0.98
IGL01556:Cdh11 APN 8 102679644 missense probably damaging 1.00
IGL01964:Cdh11 APN 8 102664743 missense probably benign 0.03
IGL02322:Cdh11 APN 8 102647519 missense probably benign 0.01
IGL03094:Cdh11 APN 8 102658403 missense probably benign
IGL03110:Cdh11 APN 8 102673870 missense probably damaging 1.00
IGL03391:Cdh11 APN 8 102674023 missense possibly damaging 0.89
R0401:Cdh11 UTSW 8 102674006 missense probably damaging 1.00
R0466:Cdh11 UTSW 8 102670058 missense possibly damaging 0.89
R0731:Cdh11 UTSW 8 102668019 missense probably damaging 1.00
R0925:Cdh11 UTSW 8 102634724 missense probably damaging 1.00
R1597:Cdh11 UTSW 8 102650711 missense probably benign 0.06
R1624:Cdh11 UTSW 8 102664601 splice site probably benign
R1829:Cdh11 UTSW 8 102634641 missense possibly damaging 0.92
R2029:Cdh11 UTSW 8 102679772 missense probably benign 0.00
R4191:Cdh11 UTSW 8 102650748 missense probably damaging 0.98
R4270:Cdh11 UTSW 8 102664626 missense possibly damaging 0.69
R4271:Cdh11 UTSW 8 102664626 missense possibly damaging 0.69
R4455:Cdh11 UTSW 8 102647823 missense probably benign
R4516:Cdh11 UTSW 8 102673962 missense possibly damaging 0.59
R4900:Cdh11 UTSW 8 102647458 splice site probably null
R5441:Cdh11 UTSW 8 102647546 missense probably benign 0.11
R5699:Cdh11 UTSW 8 102634543 missense probably damaging 0.96
R6170:Cdh11 UTSW 8 102634810 missense probably benign 0.00
R6846:Cdh11 UTSW 8 102664644 missense probably damaging 0.97
R7018:Cdh11 UTSW 8 102634321 missense possibly damaging 0.82
R7095:Cdh11 UTSW 8 102658267 missense probably damaging 1.00
R7632:Cdh11 UTSW 8 102673883 missense probably damaging 0.99
R7715:Cdh11 UTSW 8 102664714 missense possibly damaging 0.66
R8321:Cdh11 UTSW 8 102634784 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCCTTCCAGACTTCTTAGTTAATAGG -3'
(R):5'- CAGGGAACATTCATGCCACC -3'

Sequencing Primer
(F):5'- CATGCAGTTTACCTTGGAGGCC -3'
(R):5'- ATTCATGCCACCAAGACATTG -3'
Posted On2019-10-17