Incidental Mutation 'R7497:Muc16'
ID 581144
Institutional Source Beutler Lab
Gene Symbol Muc16
Ensembl Gene ENSMUSG00000109564
Gene Name mucin 16
Synonyms 1110008I14Rik, LOC385009, Gm21044
MMRRC Submission 045570-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.205) question?
Stock # R7497 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 18406751-18585826 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 18556385 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 3303 (E3303K)
Ref Sequence ENSEMBL: ENSMUSP00000147104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000208663]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000208663
AA Change: E3303K
Meta Mutation Damage Score 0.0852 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (70/70)
MGI Phenotype PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 T A 15: 91,075,379 (GRCm39) I145F probably benign Het
Acvr2b T A 9: 119,262,352 (GRCm39) V455E probably benign Het
Adgrv1 A T 13: 81,588,344 (GRCm39) V4414E possibly damaging Het
Agap2 T C 10: 126,926,834 (GRCm39) V977A probably damaging Het
Aph1b A C 9: 66,701,401 (GRCm39) S79A probably damaging Het
Atm G A 9: 53,423,191 (GRCm39) S645L probably benign Het
Cdh11 T C 8: 103,400,456 (GRCm39) R171G probably benign Het
Ces2f T A 8: 105,681,330 (GRCm39) D556E probably benign Het
Cfap210 A C 2: 69,588,792 (GRCm39) N439K probably benign Het
Cyp26b1 C A 6: 84,553,964 (GRCm39) V218L possibly damaging Het
Diaph1 T C 18: 38,028,353 (GRCm39) probably null Het
Dock1 A G 7: 134,367,003 (GRCm39) I482V probably benign Het
Dok4 A T 8: 95,594,053 (GRCm39) D47E possibly damaging Het
Dqx1 T A 6: 83,036,028 (GRCm39) L120Q probably damaging Het
Duxf3 A T 10: 58,066,558 (GRCm39) V157E probably damaging Het
Efcab3 T C 11: 104,653,516 (GRCm39) probably null Het
Eif2a C A 3: 58,456,102 (GRCm39) P367Q probably damaging Het
Elp2 C T 18: 24,744,985 (GRCm39) R102C probably damaging Het
Erich2 T C 2: 70,364,666 (GRCm39) S347P probably damaging Het
Fgfr3 GGACCTCTCCGTG GG 5: 33,892,766 (GRCm39) probably null Het
Flacc1 T A 1: 58,717,467 (GRCm39) D148V probably damaging Het
Gadl1 A T 9: 115,903,155 (GRCm39) I495L probably benign Het
Gcnt4 A G 13: 97,083,468 (GRCm39) T255A possibly damaging Het
Gm10972 A G 3: 94,550,887 (GRCm39) K21E unknown Het
Gm57859 T A 11: 113,583,223 (GRCm39) W517R probably damaging Het
Gm7361 C A 5: 26,466,188 (GRCm39) H183Q probably benign Het
Gp2 C T 7: 119,053,829 (GRCm39) C44Y probably damaging Het
Hcar2 C T 5: 124,003,249 (GRCm39) V85I probably benign Het
Hira T C 16: 18,770,829 (GRCm39) V822A probably damaging Het
Ighv1-5 T A 12: 114,477,156 (GRCm39) T49S probably damaging Het
Ints1 C T 5: 139,754,731 (GRCm39) V603M probably damaging Het
Kdm2a A C 19: 4,374,404 (GRCm39) L909R probably damaging Het
Klkb1 T A 8: 45,747,827 (GRCm39) probably benign Het
Krit1 A G 5: 3,862,349 (GRCm39) H168R possibly damaging Het
Map3k21 A T 8: 126,654,340 (GRCm39) E386D probably damaging Het
Muc5b T G 7: 141,415,250 (GRCm39) V2732G possibly damaging Het
Myo5a T C 9: 75,104,983 (GRCm39) L189P Het
Nlrc5 T C 8: 95,248,598 (GRCm39) L1740S probably damaging Het
Nolc1 A G 19: 46,071,257 (GRCm39) K402R probably benign Het
Or4b1b T A 2: 90,112,098 (GRCm39) T274S possibly damaging Het
Or4k15 T A 14: 50,364,952 (GRCm39) L306Q probably benign Het
Or52s19 T C 7: 103,008,219 (GRCm39) M61V probably damaging Het
Or8u8 T C 2: 86,012,417 (GRCm39) I13V probably benign Het
Pnma8b A G 7: 16,678,874 (GRCm39) probably benign Het
Pnpt1 A T 11: 29,080,860 (GRCm39) M35L probably benign Het
Postn A G 3: 54,270,091 (GRCm39) K57E probably damaging Het
Ppp1r9a A C 6: 4,905,775 (GRCm39) D110A probably damaging Het
Pptc7 G A 5: 122,422,942 (GRCm39) V71M possibly damaging Het
Prdm11 T A 2: 92,843,052 (GRCm39) I136F possibly damaging Het
Rfc1 A G 5: 65,436,841 (GRCm39) L613P probably damaging Het
Ryr3 T C 2: 112,560,818 (GRCm39) D2981G probably benign Het
Sbf2 C A 7: 110,213,923 (GRCm39) E16* probably null Het
Scara3 T C 14: 66,168,651 (GRCm39) E322G probably damaging Het
Sema5b T A 16: 35,481,700 (GRCm39) C893S probably damaging Het
Setdb1 T C 3: 95,249,139 (GRCm39) D323G probably damaging Het
Slc19a3 T C 1: 82,991,649 (GRCm39) Y453C probably damaging Het
Snx5 T C 2: 144,099,894 (GRCm39) K137E probably damaging Het
Taar8c G A 10: 23,977,116 (GRCm39) T232I probably benign Het
Taok2 G A 7: 126,474,050 (GRCm39) T352I probably damaging Het
Ttc3 C A 16: 94,219,541 (GRCm39) R489S possibly damaging Het
Usp12 A T 5: 146,689,264 (GRCm39) probably null Het
Usp16 T A 16: 87,263,174 (GRCm39) C125* probably null Het
Vmn2r106 C T 17: 20,488,201 (GRCm39) E733K probably damaging Het
Vps13b T A 15: 35,876,843 (GRCm39) I2832K probably benign Het
Vps13c A G 9: 67,747,761 (GRCm39) Y18C probably damaging Het
Zfp160 T A 17: 21,246,455 (GRCm39) I335K probably benign Het
Zfp788 A T 7: 41,298,275 (GRCm39) I304F possibly damaging Het
Other mutations in Muc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Muc16 APN 9 18,419,803 (GRCm39) missense possibly damaging 0.89
IGL01878:Muc16 APN 9 18,406,839 (GRCm39) missense possibly damaging 0.90
IGL02394:Muc16 APN 9 18,409,996 (GRCm39) missense probably damaging 0.99
IGL02553:Muc16 APN 9 18,409,849 (GRCm39) critical splice donor site probably null
Brimming UTSW 9 18,503,976 (GRCm39) missense probably damaging 0.99
R7038_muc16_859 UTSW 9 18,531,764 (GRCm39) missense probably damaging 0.99
Runneymeade UTSW 9 18,490,613 (GRCm39) critical splice donor site probably null
slimey UTSW 9 18,501,994 (GRCm39) missense probably damaging 1.00
viscous UTSW 9 18,556,028 (GRCm39) missense unknown
R0400:Muc16 UTSW 9 18,421,830 (GRCm39) missense possibly damaging 0.74
R1620:Muc16 UTSW 9 18,421,773 (GRCm39) missense possibly damaging 0.89
R1695:Muc16 UTSW 9 18,408,729 (GRCm39) missense probably damaging 1.00
R3196:Muc16 UTSW 9 18,409,126 (GRCm39) missense probably damaging 1.00
R5982:Muc16 UTSW 9 18,558,442 (GRCm39) missense unknown
R5990:Muc16 UTSW 9 18,570,539 (GRCm39) missense unknown
R6024:Muc16 UTSW 9 18,557,967 (GRCm39) missense unknown
R6026:Muc16 UTSW 9 18,571,154 (GRCm39) missense unknown
R6028:Muc16 UTSW 9 18,568,472 (GRCm39) missense unknown
R6083:Muc16 UTSW 9 18,568,508 (GRCm39) missense unknown
R6089:Muc16 UTSW 9 18,554,548 (GRCm39) missense unknown
R6109:Muc16 UTSW 9 18,566,655 (GRCm39) missense unknown
R6127:Muc16 UTSW 9 18,569,174 (GRCm39) missense unknown
R6130:Muc16 UTSW 9 18,501,994 (GRCm39) missense probably damaging 1.00
R6146:Muc16 UTSW 9 18,409,093 (GRCm39) missense probably damaging 0.98
R6161:Muc16 UTSW 9 18,559,114 (GRCm39) missense unknown
R6164:Muc16 UTSW 9 18,469,675 (GRCm39) missense probably damaging 1.00
R6185:Muc16 UTSW 9 18,565,769 (GRCm39) missense unknown
R6192:Muc16 UTSW 9 18,569,985 (GRCm39) missense unknown
R6217:Muc16 UTSW 9 18,566,742 (GRCm39) missense unknown
R6232:Muc16 UTSW 9 18,568,294 (GRCm39) missense unknown
R6246:Muc16 UTSW 9 18,488,363 (GRCm39) splice site probably null
R6255:Muc16 UTSW 9 18,566,895 (GRCm39) missense unknown
R6280:Muc16 UTSW 9 18,490,613 (GRCm39) critical splice donor site probably null
R6286:Muc16 UTSW 9 18,555,685 (GRCm39) missense unknown
R6287:Muc16 UTSW 9 18,570,330 (GRCm39) missense unknown
R6307:Muc16 UTSW 9 18,558,884 (GRCm39) missense unknown
R6310:Muc16 UTSW 9 18,553,246 (GRCm39) missense probably benign 0.00
R6316:Muc16 UTSW 9 18,553,115 (GRCm39) missense probably benign 0.01
R6335:Muc16 UTSW 9 18,572,004 (GRCm39) missense unknown
R6345:Muc16 UTSW 9 18,566,222 (GRCm39) missense unknown
R6349:Muc16 UTSW 9 18,568,625 (GRCm39) missense unknown
R6366:Muc16 UTSW 9 18,557,340 (GRCm39) missense unknown
R6393:Muc16 UTSW 9 18,558,695 (GRCm39) nonsense probably null
R6440:Muc16 UTSW 9 18,552,655 (GRCm39) missense probably benign 0.01
R6458:Muc16 UTSW 9 18,553,017 (GRCm39) missense probably benign 0.01
R6460:Muc16 UTSW 9 18,551,812 (GRCm39) missense probably benign 0.01
R6481:Muc16 UTSW 9 18,461,973 (GRCm39) critical splice donor site probably null
R6539:Muc16 UTSW 9 18,548,621 (GRCm39) missense probably benign 0.25
R6551:Muc16 UTSW 9 18,473,858 (GRCm39) missense possibly damaging 0.95
R6596:Muc16 UTSW 9 18,478,011 (GRCm39) missense probably benign 0.18
R6601:Muc16 UTSW 9 18,548,866 (GRCm39) missense probably benign 0.10
R6602:Muc16 UTSW 9 18,520,772 (GRCm39) splice site probably null
R6615:Muc16 UTSW 9 18,558,484 (GRCm39) missense unknown
R6625:Muc16 UTSW 9 18,571,574 (GRCm39) missense unknown
R6668:Muc16 UTSW 9 18,551,681 (GRCm39) missense probably benign 0.03
R6697:Muc16 UTSW 9 18,552,587 (GRCm39) missense probably benign 0.01
R6710:Muc16 UTSW 9 18,553,366 (GRCm39) missense possibly damaging 0.95
R6727:Muc16 UTSW 9 18,477,986 (GRCm39) critical splice donor site probably null
R6789:Muc16 UTSW 9 18,471,282 (GRCm39) missense probably benign 0.40
R6806:Muc16 UTSW 9 18,449,206 (GRCm39) critical splice donor site probably null
R6874:Muc16 UTSW 9 18,570,065 (GRCm39) nonsense probably null
R6894:Muc16 UTSW 9 18,406,872 (GRCm39) missense possibly damaging 0.92
R6913:Muc16 UTSW 9 18,553,959 (GRCm39) missense unknown
R6919:Muc16 UTSW 9 18,571,595 (GRCm39) missense unknown
R6939:Muc16 UTSW 9 18,549,833 (GRCm39) missense probably benign 0.04
R6953:Muc16 UTSW 9 18,551,825 (GRCm39) missense probably benign 0.01
R6956:Muc16 UTSW 9 18,556,322 (GRCm39) missense unknown
R6977:Muc16 UTSW 9 18,556,633 (GRCm39) missense unknown
R6996:Muc16 UTSW 9 18,557,193 (GRCm39) missense unknown
R7011:Muc16 UTSW 9 18,548,839 (GRCm39) missense probably benign 0.10
R7011:Muc16 UTSW 9 18,548,747 (GRCm39) missense probably benign 0.26
R7012:Muc16 UTSW 9 18,406,914 (GRCm39) critical splice acceptor site probably null
R7014:Muc16 UTSW 9 18,569,532 (GRCm39) missense unknown
R7021:Muc16 UTSW 9 18,462,127 (GRCm39) splice site probably null
R7021:Muc16 UTSW 9 18,466,215 (GRCm39) missense unknown
R7038:Muc16 UTSW 9 18,531,764 (GRCm39) missense probably damaging 0.99
R7057:Muc16 UTSW 9 18,557,375 (GRCm39) missense unknown
R7058:Muc16 UTSW 9 18,551,051 (GRCm39) missense probably benign 0.10
R7066:Muc16 UTSW 9 18,569,317 (GRCm39) missense unknown
R7067:Muc16 UTSW 9 18,569,547 (GRCm39) missense unknown
R7070:Muc16 UTSW 9 18,557,219 (GRCm39) nonsense probably null
R7074:Muc16 UTSW 9 18,566,946 (GRCm39) missense unknown
R7085:Muc16 UTSW 9 18,556,145 (GRCm39) missense unknown
R7088:Muc16 UTSW 9 18,503,976 (GRCm39) missense probably damaging 0.99
R7107:Muc16 UTSW 9 18,548,594 (GRCm39) missense probably benign 0.10
R7108:Muc16 UTSW 9 18,566,529 (GRCm39) missense unknown
R7126:Muc16 UTSW 9 18,552,512 (GRCm39) missense probably benign 0.01
R7128:Muc16 UTSW 9 18,554,300 (GRCm39) missense unknown
R7145:Muc16 UTSW 9 18,566,876 (GRCm39) missense unknown
R7179:Muc16 UTSW 9 18,553,304 (GRCm39) missense probably benign 0.00
R7194:Muc16 UTSW 9 18,585,750 (GRCm39) missense unknown
R7211:Muc16 UTSW 9 18,409,866 (GRCm39) missense probably damaging 1.00
R7213:Muc16 UTSW 9 18,552,712 (GRCm39) missense probably benign 0.01
R7217:Muc16 UTSW 9 18,555,372 (GRCm39) nonsense probably null
R7221:Muc16 UTSW 9 18,553,495 (GRCm39) missense probably benign 0.04
R7265:Muc16 UTSW 9 18,567,768 (GRCm39) missense unknown
R7326:Muc16 UTSW 9 18,496,309 (GRCm39) missense probably benign 0.03
R7359:Muc16 UTSW 9 18,554,316 (GRCm39) missense unknown
R7387:Muc16 UTSW 9 18,553,016 (GRCm39) missense probably benign 0.01
R7391:Muc16 UTSW 9 18,550,832 (GRCm39) missense probably benign 0.04
R7398:Muc16 UTSW 9 18,549,038 (GRCm39) missense possibly damaging 0.46
R7419:Muc16 UTSW 9 18,553,258 (GRCm39) missense probably benign 0.01
R7431:Muc16 UTSW 9 18,519,289 (GRCm39) missense
R7484:Muc16 UTSW 9 18,558,064 (GRCm39) missense unknown
R7487:Muc16 UTSW 9 18,496,095 (GRCm39) missense possibly damaging 0.93
R7515:Muc16 UTSW 9 18,550,958 (GRCm39) missense probably benign 0.00
R7537:Muc16 UTSW 9 18,549,431 (GRCm39) missense probably benign 0.06
R7538:Muc16 UTSW 9 18,566,747 (GRCm39) missense unknown
R7538:Muc16 UTSW 9 18,553,427 (GRCm39) missense probably benign 0.10
R7543:Muc16 UTSW 9 18,556,028 (GRCm39) missense unknown
R7566:Muc16 UTSW 9 18,549,925 (GRCm39) missense probably benign 0.00
R7581:Muc16 UTSW 9 18,556,910 (GRCm39) missense unknown
R7594:Muc16 UTSW 9 18,556,358 (GRCm39) missense unknown
R7629:Muc16 UTSW 9 18,478,081 (GRCm39) missense possibly damaging 0.86
R7664:Muc16 UTSW 9 18,519,018 (GRCm39) missense probably benign 0.08
R7666:Muc16 UTSW 9 18,469,723 (GRCm39) missense probably damaging 1.00
R7703:Muc16 UTSW 9 18,516,578 (GRCm39) missense
R7727:Muc16 UTSW 9 18,571,538 (GRCm39) missense unknown
R7743:Muc16 UTSW 9 18,568,773 (GRCm39) missense unknown
R7744:Muc16 UTSW 9 18,496,392 (GRCm39) critical splice acceptor site probably null
R7761:Muc16 UTSW 9 18,491,870 (GRCm39) missense probably damaging 1.00
R7769:Muc16 UTSW 9 18,571,803 (GRCm39) missense unknown
R7805:Muc16 UTSW 9 18,549,789 (GRCm39) missense possibly damaging 0.94
R7827:Muc16 UTSW 9 18,506,519 (GRCm39) missense possibly damaging 0.83
R7845:Muc16 UTSW 9 18,552,069 (GRCm39) missense probably benign 0.01
R7849:Muc16 UTSW 9 18,551,801 (GRCm39) missense probably benign 0.01
R7884:Muc16 UTSW 9 18,553,990 (GRCm39) missense unknown
R7885:Muc16 UTSW 9 18,550,760 (GRCm39) missense probably benign 0.10
R7886:Muc16 UTSW 9 18,497,278 (GRCm39) missense probably benign 0.03
R7899:Muc16 UTSW 9 18,551,993 (GRCm39) missense probably benign 0.01
R7904:Muc16 UTSW 9 18,566,946 (GRCm39) missense unknown
R7921:Muc16 UTSW 9 18,570,614 (GRCm39) missense unknown
R7922:Muc16 UTSW 9 18,496,121 (GRCm39) missense probably benign 0.16
R7948:Muc16 UTSW 9 18,553,786 (GRCm39) missense unknown
R7957:Muc16 UTSW 9 18,554,767 (GRCm39) missense unknown
R7972:Muc16 UTSW 9 18,557,060 (GRCm39) nonsense probably null
R7992:Muc16 UTSW 9 18,567,725 (GRCm39) missense unknown
R7998:Muc16 UTSW 9 18,551,188 (GRCm39) missense probably benign 0.04
R8014:Muc16 UTSW 9 18,566,171 (GRCm39) missense unknown
R8033:Muc16 UTSW 9 18,547,902 (GRCm39) missense probably benign 0.26
R8052:Muc16 UTSW 9 18,570,347 (GRCm39) missense unknown
R8058:Muc16 UTSW 9 18,571,298 (GRCm39) nonsense probably null
R8088:Muc16 UTSW 9 18,430,596 (GRCm39) nonsense probably null
R8095:Muc16 UTSW 9 18,496,126 (GRCm39) nonsense probably null
R8111:Muc16 UTSW 9 18,503,925 (GRCm39) missense possibly damaging 0.55
R8116:Muc16 UTSW 9 18,570,033 (GRCm39) missense unknown
R8117:Muc16 UTSW 9 18,420,206 (GRCm39) nonsense probably null
R8137:Muc16 UTSW 9 18,556,972 (GRCm39) missense unknown
R8196:Muc16 UTSW 9 18,556,630 (GRCm39) missense unknown
R8218:Muc16 UTSW 9 18,548,315 (GRCm39) missense possibly damaging 0.48
R8285:Muc16 UTSW 9 18,554,273 (GRCm39) missense unknown
R8313:Muc16 UTSW 9 18,436,443 (GRCm39) missense possibly damaging 0.85
R8317:Muc16 UTSW 9 18,569,339 (GRCm39) missense unknown
R8342:Muc16 UTSW 9 18,569,981 (GRCm39) missense unknown
R8351:Muc16 UTSW 9 18,571,181 (GRCm39) missense unknown
R8356:Muc16 UTSW 9 18,570,074 (GRCm39) missense unknown
R8360:Muc16 UTSW 9 18,436,554 (GRCm39) missense probably benign 0.01
R8418:Muc16 UTSW 9 18,430,926 (GRCm39) missense possibly damaging 0.94
R8420:Muc16 UTSW 9 18,448,807 (GRCm39) missense probably damaging 0.99
R8437:Muc16 UTSW 9 18,569,220 (GRCm39) missense unknown
R8463:Muc16 UTSW 9 18,570,435 (GRCm39) missense unknown
R8466:Muc16 UTSW 9 18,554,444 (GRCm39) missense unknown
R8512:Muc16 UTSW 9 18,549,488 (GRCm39) missense probably benign 0.01
R8518:Muc16 UTSW 9 18,430,927 (GRCm39) missense probably benign 0.12
R8556:Muc16 UTSW 9 18,552,233 (GRCm39) missense probably benign 0.01
R8679:Muc16 UTSW 9 18,557,744 (GRCm39) missense unknown
R8680:Muc16 UTSW 9 18,556,015 (GRCm39) missense unknown
R8720:Muc16 UTSW 9 18,552,896 (GRCm39) missense probably benign 0.01
R8729:Muc16 UTSW 9 18,571,346 (GRCm39) missense unknown
R8736:Muc16 UTSW 9 18,462,139 (GRCm39) nonsense probably null
R8739:Muc16 UTSW 9 18,548,594 (GRCm39) missense probably benign 0.10
R8807:Muc16 UTSW 9 18,567,353 (GRCm39) missense unknown
R8830:Muc16 UTSW 9 18,557,365 (GRCm39) missense unknown
R8871:Muc16 UTSW 9 18,567,344 (GRCm39) missense unknown
R8884:Muc16 UTSW 9 18,555,496 (GRCm39) missense unknown
R8923:Muc16 UTSW 9 18,549,972 (GRCm39) missense probably benign 0.01
R8948:Muc16 UTSW 9 18,558,529 (GRCm39) missense unknown
R8949:Muc16 UTSW 9 18,432,221 (GRCm39) critical splice donor site probably null
R8987:Muc16 UTSW 9 18,462,981 (GRCm39) nonsense probably null
R8997:Muc16 UTSW 9 18,518,763 (GRCm39) intron probably benign
R9013:Muc16 UTSW 9 18,424,069 (GRCm39) missense possibly damaging 0.94
R9020:Muc16 UTSW 9 18,550,015 (GRCm39) small insertion probably benign
R9036:Muc16 UTSW 9 18,555,975 (GRCm39) missense unknown
R9040:Muc16 UTSW 9 18,556,082 (GRCm39) nonsense probably null
R9065:Muc16 UTSW 9 18,554,305 (GRCm39) missense unknown
R9089:Muc16 UTSW 9 18,555,846 (GRCm39) missense unknown
R9098:Muc16 UTSW 9 18,554,975 (GRCm39) missense unknown
R9100:Muc16 UTSW 9 18,556,966 (GRCm39) missense unknown
R9128:Muc16 UTSW 9 18,558,878 (GRCm39) missense unknown
R9169:Muc16 UTSW 9 18,567,824 (GRCm39) missense unknown
R9180:Muc16 UTSW 9 18,554,038 (GRCm39) missense unknown
R9191:Muc16 UTSW 9 18,556,106 (GRCm39) missense unknown
R9203:Muc16 UTSW 9 18,462,984 (GRCm39) missense unknown
R9208:Muc16 UTSW 9 18,419,833 (GRCm39) missense probably damaging 0.99
R9232:Muc16 UTSW 9 18,567,336 (GRCm39) missense unknown
R9240:Muc16 UTSW 9 18,449,309 (GRCm39) missense unknown
R9254:Muc16 UTSW 9 18,557,467 (GRCm39) missense unknown
R9330:Muc16 UTSW 9 18,552,332 (GRCm39) missense probably benign 0.04
R9347:Muc16 UTSW 9 18,571,511 (GRCm39) missense unknown
R9358:Muc16 UTSW 9 18,553,520 (GRCm39) missense probably benign 0.01
R9359:Muc16 UTSW 9 18,449,060 (GRCm39) critical splice donor site probably null
R9379:Muc16 UTSW 9 18,557,467 (GRCm39) missense unknown
R9403:Muc16 UTSW 9 18,449,060 (GRCm39) critical splice donor site probably null
R9422:Muc16 UTSW 9 18,553,102 (GRCm39) missense probably benign 0.01
R9433:Muc16 UTSW 9 18,483,937 (GRCm39) missense probably benign 0.09
R9438:Muc16 UTSW 9 18,559,028 (GRCm39) missense unknown
R9442:Muc16 UTSW 9 18,566,624 (GRCm39) missense unknown
R9453:Muc16 UTSW 9 18,572,061 (GRCm39) missense unknown
R9467:Muc16 UTSW 9 18,508,331 (GRCm39) missense probably benign 0.03
R9490:Muc16 UTSW 9 18,568,149 (GRCm39) nonsense probably null
R9519:Muc16 UTSW 9 18,498,216 (GRCm39) missense probably benign 0.03
R9524:Muc16 UTSW 9 18,497,314 (GRCm39) missense probably benign 0.03
R9556:Muc16 UTSW 9 18,569,934 (GRCm39) missense unknown
R9583:Muc16 UTSW 9 18,549,973 (GRCm39) missense probably benign 0.01
R9600:Muc16 UTSW 9 18,567,147 (GRCm39) missense unknown
R9638:Muc16 UTSW 9 18,550,626 (GRCm39) missense probably benign 0.12
R9650:Muc16 UTSW 9 18,553,762 (GRCm39) missense unknown
R9652:Muc16 UTSW 9 18,498,178 (GRCm39) missense probably benign 0.03
R9666:Muc16 UTSW 9 18,567,285 (GRCm39) missense unknown
R9682:Muc16 UTSW 9 18,553,874 (GRCm39) missense unknown
R9765:Muc16 UTSW 9 18,548,494 (GRCm39) missense probably benign 0.16
R9766:Muc16 UTSW 9 18,552,383 (GRCm39) missense probably benign 0.01
R9766:Muc16 UTSW 9 18,548,153 (GRCm39) missense probably benign 0.08
R9776:Muc16 UTSW 9 18,570,675 (GRCm39) missense unknown
R9782:Muc16 UTSW 9 18,548,066 (GRCm39) missense possibly damaging 0.64
Z1177:Muc16 UTSW 9 18,569,157 (GRCm39) nonsense probably null
Z1177:Muc16 UTSW 9 18,448,867 (GRCm39) missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TTTGATCCCAGGAAACATCTAGAG -3'
(R):5'- ATCTGTGCCTTCTCAGGGTG -3'

Sequencing Primer
(F):5'- GAGCTGAAGTAACTGAATTCCCTTC -3'
(R):5'- TGGCTCTCCAGGTATAATGAAAGTG -3'
Posted On 2019-10-17