Mutagenetix > Incidental Mutation

Incidental Mutation 'R7497:Myo5a'

581148

Institutional Source

Beutler Lab

Gene Symbol

Myo5a

Ensembl Gene

ENSMUSG00000034593

Gene Name

myosin VA

Synonyms

9630007J19Rik, Dbv, flail, MVa, Myo5, MyoVA

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.957) question?

Stock #

R7497 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

75071015-75223688 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 75197701 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 189 (L189P)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000123128] [ENSMUST00000129281] [ENSMUST00000136731] [ENSMUST00000148144] [ENSMUST00000155282]

AlphaFold

Q99104

Predicted Effect

probably damaging
Transcript: ENSMUST00000123128
AA Change: L1431P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000116028
Gene: ENSMUSG00000034593
AA Change: L1431P

Domain	Start	End	E-Value	Type
MYSc	63	764	N/A	SMART
IQ	765	787	3.65e-4	SMART
IQ	788	810	1.56e-3	SMART
IQ	813	835	3.05e-6	SMART
IQ	836	858	8.38e-4	SMART
IQ	861	883	1.09e-2	SMART
IQ	884	906	6.97e0	SMART
coiled coil region	1153	1234	N/A	INTRINSIC
coiled coil region	1314	1364	N/A	INTRINSIC
coiled coil region	1406	1443	N/A	INTRINSIC
DIL	1685	1790	2.47e-51	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000129281

SMART Domains

Protein: ENSMUSP00000118881
Gene: ENSMUSG00000034593

Domain	Start	End	E-Value	Type
coiled coil region	1	27	N/A	INTRINSIC
coiled coil region	129	181	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000114803
Gene: ENSMUSG00000034593
AA Change: L189P

Domain	Start	End	E-Value	Type
coiled coil region	95	201	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000136731
AA Change: L1406P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000120444
Gene: ENSMUSG00000034593
AA Change: L1406P

Domain	Start	End	E-Value	Type
MYSc	63	764	N/A	SMART
IQ	765	787	3.65e-4	SMART
IQ	788	810	1.56e-3	SMART
IQ	813	835	3.05e-6	SMART
IQ	836	858	8.38e-4	SMART
IQ	861	883	1.09e-2	SMART
IQ	884	906	6.97e0	SMART
coiled coil region	1153	1234	N/A	INTRINSIC
coiled coil region	1314	1418	N/A	INTRINSIC
DIL	1660	1765	2.47e-51	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000148144
AA Change: L163P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000121158
Gene: ENSMUSG00000034593
AA Change: L163P

Domain	Start	End	E-Value	Type
coiled coil region	71	175	N/A	INTRINSIC
Blast:DIL	275	305	4e-13	BLAST
Blast:DIL	330	355	5e-6	BLAST
DIL	417	522	2.47e-51	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000155282
AA Change: L1433P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000117493
Gene: ENSMUSG00000034593
AA Change: L1433P

Domain	Start	End	E-Value	Type
MYSc	63	764	N/A	SMART
IQ	765	787	3.65e-4	SMART
IQ	788	810	1.56e-3	SMART
IQ	813	835	3.05e-6	SMART
IQ	836	858	8.38e-4	SMART
IQ	861	883	1.09e-2	SMART
IQ	884	906	6.97e0	SMART
coiled coil region	1153	1234	N/A	INTRINSIC
coiled coil region	1339	1445	N/A	INTRINSIC
DIL	1687	1792	2.47e-51	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (70/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three myosin V heavy-chain genes, belonging to the myosin gene superfamily. Myosin V is a class of actin-based motor proteins involved in cytoplasmic vesicle transport and anchorage, spindle-pole alignment and mRNA translocation. The protein encoded by this gene is abundant in melanocytes and nerve cells. Mutations in this gene cause Griscelli syndrome type-1 (GS1), Griscelli syndrome type-3 (GS3) and neuroectodermal melanolysosomal disease, or Elejalde disease. Multiple alternatively spliced transcript variants encoding different isoforms have been reported, but the full-length nature of some variants has not been determined. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mutations in this gene result in diluted coat color, behavioral deficits including opisthotonus, and postnatal or premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcd2	T	A	15: 91,191,176	I145F	probably benign	Het
Acvr2b	T	A	9: 119,433,286	V455E	probably benign	Het
Adgrv1	A	T	13: 81,440,225	V4414E	possibly damaging	Het
Agap2	T	C	10: 127,090,965	V977A	probably damaging	Het
Als2cr12	T	A	1: 58,678,308	D148V	probably damaging	Het
Aph1b	A	C	9: 66,794,119	S79A	probably damaging	Het
Atm	G	A	9: 53,511,891	S645L	probably benign	Het
Ccdc173	A	C	2: 69,758,448	N439K	probably benign	Het
Cdh11	T	C	8: 102,673,824	R171G	probably benign	Het
Ces2f	T	A	8: 104,954,698	D556E	probably benign	Het
Cyp26b1	C	A	6: 84,576,982	V218L	possibly damaging	Het
D11Wsu47e	T	A	11: 113,692,397	W517R	probably damaging	Het
Diaph1	T	C	18: 37,895,300		probably null	Het
Dock1	A	G	7: 134,765,274	I482V	probably benign	Het
Dok4	A	T	8: 94,867,425	D47E	possibly damaging	Het
Dqx1	T	A	6: 83,059,047	L120Q	probably damaging	Het
Duxf3	A	T	10: 58,230,736	V157E	probably damaging	Het
Eif2a	C	A	3: 58,548,681	P367Q	probably damaging	Het
Elp2	C	T	18: 24,611,928	R102C	probably damaging	Het
Erich2	T	C	2: 70,534,322	S347P	probably damaging	Het
Fgfr3	GGACCTCTCCGTG	GG	5: 33,735,422		probably null	Het
Gadl1	A	T	9: 116,074,087	I495L	probably benign	Het
Gcnt4	A	G	13: 96,946,960	T255A	possibly damaging	Het
Gm10972	A	G	3: 94,643,580	K21E	unknown	Het
Gm11639	T	C	11: 104,762,690		probably null	Het
Gm7361	C	A	5: 26,261,190	H183Q	probably benign	Het
Gp2	C	T	7: 119,454,606	C44Y	probably damaging	Het
Hcar2	C	T	5: 123,865,186	V85I	probably benign	Het
Hira	T	C	16: 18,952,079	V822A	probably damaging	Het
Ighv1-5	T	A	12: 114,513,536	T49S	probably damaging	Het
Ints1	C	T	5: 139,768,976	V603M	probably damaging	Het
Kdm2a	A	C	19: 4,324,376	L909R	probably damaging	Het
Klkb1	T	A	8: 45,294,790		probably benign	Het
Krit1	A	G	5: 3,812,349	H168R	possibly damaging	Het
Map3k21	A	T	8: 125,927,601	E386D	probably damaging	Het
Muc16	C	T	9: 18,645,089	E3303K	unknown	Het
Muc5b	T	G	7: 141,861,513	V2732G	possibly damaging	Het
Nlrc5	T	C	8: 94,521,970	L1740S	probably damaging	Het
Nolc1	A	G	19: 46,082,818	K402R	probably benign	Het
Olfr1272	T	A	2: 90,281,754	T274S	possibly damaging	Het
Olfr52	T	C	2: 86,182,073	I13V	probably benign	Het
Olfr601	T	C	7: 103,359,012	M61V	probably damaging	Het
Olfr727	T	A	14: 50,127,495	L306Q	probably benign	Het
Pnmal2	A	G	7: 16,944,949		probably benign	Het
Pnpt1	A	T	11: 29,130,860	M35L	probably benign	Het
Postn	A	G	3: 54,362,670	K57E	probably damaging	Het
Ppp1r9a	A	C	6: 4,905,775	D110A	probably damaging	Het
Pptc7	G	A	5: 122,284,879	V71M	possibly damaging	Het
Prdm11	T	A	2: 93,012,707	I136F	possibly damaging	Het
Rfc1	A	G	5: 65,279,498	L613P	probably damaging	Het
Ryr3	T	C	2: 112,730,473	D2981G	probably benign	Het
Sbf2	C	A	7: 110,614,716	E16*	probably null	Het
Scara3	T	C	14: 65,931,202	E322G	probably damaging	Het
Sema5b	T	A	16: 35,661,330	C893S	probably damaging	Het
Setdb1	T	C	3: 95,341,828	D323G	probably damaging	Het
Slc19a3	T	C	1: 83,013,928	Y453C	probably damaging	Het
Snx5	T	C	2: 144,257,974	K137E	probably damaging	Het
Taar8c	G	A	10: 24,101,218	T232I	probably benign	Het
Taok2	G	A	7: 126,874,878	T352I	probably damaging	Het
Ttc3	C	A	16: 94,418,682	R489S	possibly damaging	Het
Usp12	A	T	5: 146,752,454		probably null	Het
Usp16	T	A	16: 87,466,286	C125*	probably null	Het
Vmn2r106	C	T	17: 20,267,939	E733K	probably damaging	Het
Vps13b	T	A	15: 35,876,697	I2832K	probably benign	Het
Vps13c	A	G	9: 67,840,479	Y18C	probably damaging	Het
Zfp160	T	A	17: 21,026,193	I335K	probably benign	Het
Zfp788	A	T	7: 41,648,851	I304F	possibly damaging	Het

Other mutations in Myo5a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Myo5a	APN	9	75161497	nonsense	probably null
IGL00547:Myo5a	APN	9	75141453	missense	probably benign	0.00
IGL00788:Myo5a	APN	9	75168959	missense	probably benign	0.15
IGL01327:Myo5a	APN	9	75187538	splice site	probably benign
IGL01687:Myo5a	APN	9	75156249	missense	probably benign	0.12
IGL01886:Myo5a	APN	9	75169090	splice site	probably benign
IGL01945:Myo5a	APN	9	75140671	missense	probably damaging	1.00
IGL02127:Myo5a	APN	9	75212981	missense	probably benign	0.12
IGL02137:Myo5a	APN	9	75161535	splice site	probably null
IGL02183:Myo5a	APN	9	75167236	splice site	probably benign
IGL02427:Myo5a	APN	9	75176618	splice site	probably benign
IGL02490:Myo5a	APN	9	75136455	missense	probably damaging	1.00
IGL02574:Myo5a	APN	9	75211147	missense	probably benign	0.00
IGL02886:Myo5a	APN	9	75151887	splice site	probably benign
IGL02961:Myo5a	APN	9	75215120	missense	probably benign	0.04
IGL03090:Myo5a	APN	9	75120833	missense	probably damaging	1.00
IGL03119:Myo5a	APN	9	75174015	missense	probably benign	0.01
IGL03237:Myo5a	APN	9	75129994	missense	probably damaging	1.00
IGL03296:Myo5a	APN	9	75116202	missense	probably damaging	1.00
naoki	UTSW	9	75161492	missense	probably damaging	1.00
new_gray	UTSW	9		missense
nut	UTSW	9		splice donor site
silver_decerebrate	UTSW	9	75164195	missense	probably damaging	1.00
silver_decerebrate_2	UTSW	9	75211127	missense	probably damaging	1.00
IGL02988:Myo5a	UTSW	9	75130141	splice site	probably benign
IGL03050:Myo5a	UTSW	9	75146909	splice site	probably null
PIT4403001:Myo5a	UTSW	9	75217523	missense	probably damaging	1.00
R0047:Myo5a	UTSW	9	75156207	missense	probably damaging	1.00
R0047:Myo5a	UTSW	9	75156207	missense	probably damaging	1.00
R0091:Myo5a	UTSW	9	75161492	missense	probably damaging	1.00
R0142:Myo5a	UTSW	9	75160574	missense	probably benign	0.01
R0243:Myo5a	UTSW	9	75186123	critical splice donor site	probably null
R0395:Myo5a	UTSW	9	75193977	missense	probably benign	0.39
R0427:Myo5a	UTSW	9	75174196	missense	probably benign	0.00
R0545:Myo5a	UTSW	9	75167037	missense	possibly damaging	0.94
R0565:Myo5a	UTSW	9	75180112	missense	probably benign	0.00
R0601:Myo5a	UTSW	9	75174015	missense	probably benign	0.01
R1457:Myo5a	UTSW	9	75213065	missense	probably damaging	0.99
R1510:Myo5a	UTSW	9	75171551	missense	probably benign
R1548:Myo5a	UTSW	9	75171746	missense	probably damaging	1.00
R1759:Myo5a	UTSW	9	75181993	missense	possibly damaging	0.72
R1924:Myo5a	UTSW	9	75116207	missense	probably damaging	1.00
R1960:Myo5a	UTSW	9	75147857	missense	probably damaging	1.00
R2050:Myo5a	UTSW	9	75146874	missense	probably benign	0.01
R2070:Myo5a	UTSW	9	75181984	missense	probably benign	0.03
R2075:Myo5a	UTSW	9	75189918	missense	probably benign	0.01
R2148:Myo5a	UTSW	9	75180147	missense	probably damaging	1.00
R2201:Myo5a	UTSW	9	75217943	missense	possibly damaging	0.51
R2337:Myo5a	UTSW	9	75203801	missense	probably damaging	1.00
R2357:Myo5a	UTSW	9	75201365	missense	probably damaging	0.99
R2392:Myo5a	UTSW	9	75209239	missense	probably benign	0.02
R2432:Myo5a	UTSW	9	75212873	missense	possibly damaging	0.89
R2568:Myo5a	UTSW	9	75123040	missense	probably damaging	1.00
R2568:Myo5a	UTSW	9	75151897	missense	probably damaging	1.00
R2932:Myo5a	UTSW	9	75196136	missense	possibly damaging	0.85
R2971:Myo5a	UTSW	9	75116202	missense	probably damaging	1.00
R4231:Myo5a	UTSW	9	75189997	missense	possibly damaging	0.67
R4293:Myo5a	UTSW	9	75144171	missense	probably benign
R4321:Myo5a	UTSW	9	75217530	missense	probably damaging	0.99
R4450:Myo5a	UTSW	9	75167176	missense	probably benign	0.00
R4573:Myo5a	UTSW	9	75201297	splice site	probably null
R4577:Myo5a	UTSW	9	75217545	missense	probably damaging	1.00
R4601:Myo5a	UTSW	9	75136388	missense	probably damaging	1.00
R4690:Myo5a	UTSW	9	75153823	missense	probably damaging	0.99
R4691:Myo5a	UTSW	9	75180156	missense	probably damaging	0.99
R4764:Myo5a	UTSW	9	75116336	intron	probably benign
R4767:Myo5a	UTSW	9	75144076	missense	probably damaging	0.99
R4811:Myo5a	UTSW	9	75141543	critical splice donor site	probably null
R4829:Myo5a	UTSW	9	75136407	missense	probably damaging	1.00
R4863:Myo5a	UTSW	9	75217507	missense	probably damaging	1.00
R4902:Myo5a	UTSW	9	75174078	missense	probably benign
R4947:Myo5a	UTSW	9	75123048	missense	probably damaging	1.00
R5074:Myo5a	UTSW	9	75174156	missense	probably benign
R5095:Myo5a	UTSW	9	75152020	missense	probably damaging	1.00
R5095:Myo5a	UTSW	9	75184389	nonsense	probably null
R5254:Myo5a	UTSW	9	75130120	missense	probably damaging	1.00
R5267:Myo5a	UTSW	9	75152010	missense	probably damaging	1.00
R5419:Myo5a	UTSW	9	75147897	missense	probably damaging	1.00
R5514:Myo5a	UTSW	9	75153766	missense	probably damaging	1.00
R5629:Myo5a	UTSW	9	75203845	missense	possibly damaging	0.89
R5649:Myo5a	UTSW	9	75171719	missense	possibly damaging	0.92
R5661:Myo5a	UTSW	9	75167206	missense	probably benign	0.02
R5665:Myo5a	UTSW	9	75144181	critical splice donor site	probably null
R5719:Myo5a	UTSW	9	75151931	missense	probably damaging	1.00
R5964:Myo5a	UTSW	9	75203833	missense	probably benign	0.09
R6014:Myo5a	UTSW	9	75167207	nonsense	probably null
R6344:Myo5a	UTSW	9	75160509	missense	probably benign	0.09
R6345:Myo5a	UTSW	9	75189913	missense	possibly damaging	0.77
R6644:Myo5a	UTSW	9	75146967	missense	probably damaging	0.98
R6712:Myo5a	UTSW	9	75212900	missense	probably benign	0.12
R6838:Myo5a	UTSW	9	75153883	critical splice donor site	probably null
R6866:Myo5a	UTSW	9	75140688	missense	probably damaging	1.00
R6876:Myo5a	UTSW	9	75160490	missense	probably benign	0.04
R7108:Myo5a	UTSW	9	75129992	missense	probably damaging	1.00
R7159:Myo5a	UTSW	9	75171563	missense	probably benign	0.07
R7164:Myo5a	UTSW	9	75180153	missense	probably benign	0.00
R7219:Myo5a	UTSW	9	75120770	missense	probably damaging	1.00
R7620:Myo5a	UTSW	9	75164136	missense	probably benign	0.41
R7719:Myo5a	UTSW	9	75144084	missense	probably benign	0.01
R7810:Myo5a	UTSW	9	75160465	missense	probably benign	0.09
R7810:Myo5a	UTSW	9	75169010	missense	probably benign
R7866:Myo5a	UTSW	9	75203752	missense	probably damaging	1.00
R7939:Myo5a	UTSW	9	75189900	missense
R8050:Myo5a	UTSW	9	75181946	missense	probably damaging	0.99
R8061:Myo5a	UTSW	9	75122957	nonsense	probably null
R8326:Myo5a	UTSW	9	75217989	missense	probably damaging	0.98
R8529:Myo5a	UTSW	9	75212872	missense	probably benign	0.02
R8824:Myo5a	UTSW	9	75167046	missense	probably damaging	1.00
R8858:Myo5a	UTSW	9	75184683	missense	probably damaging	0.99
R9040:Myo5a	UTSW	9	75174059	missense	probably benign	0.07
R9092:Myo5a	UTSW	9	75147132	critical splice donor site	probably null
R9249:Myo5a	UTSW	9	75189997	missense	possibly damaging	0.67
R9274:Myo5a	UTSW	9	75189997	missense	possibly damaging	0.67
R9293:Myo5a	UTSW	9	75180030	missense	probably benign	0.37
R9366:Myo5a	UTSW	9	75217518	missense	probably damaging	0.98
R9410:Myo5a	UTSW	9	75116214	missense	probably damaging	0.98
X0010:Myo5a	UTSW	9	75185905	missense	probably damaging	1.00
Z1177:Myo5a	UTSW	9	75186036	missense

Predicted Primers

PCR Primer
(F):5'- CCACCTGCAGCTTTTATGTG -3'
(R):5'- ACTCTGGCATGTGTTAGCTG -3'

Sequencing Primer
(F):5'- TGTGAAACTAACAGTGTGTTGC -3'
(R):5'- CATAGAAGAATTTTTCATTCCGCAG -3'

Posted On

2019-10-17