Incidental Mutation 'R7497:Myo5a'
ID 581148
Institutional Source Beutler Lab
Gene Symbol Myo5a
Ensembl Gene ENSMUSG00000034593
Gene Name myosin VA
Synonyms flail, Myo5, MVa, Dbv, 9630007J19Rik, MyoVA
MMRRC Submission 045570-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.961) question?
Stock # R7497 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 74978297-75130970 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 75104983 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 189 (L189P)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123128] [ENSMUST00000129281] [ENSMUST00000136731] [ENSMUST00000148144] [ENSMUST00000155282]
AlphaFold Q99104
Predicted Effect probably damaging
Transcript: ENSMUST00000123128
AA Change: L1431P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116028
Gene: ENSMUSG00000034593
AA Change: L1431P

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1314 1364 N/A INTRINSIC
coiled coil region 1406 1443 N/A INTRINSIC
DIL 1685 1790 2.47e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129281
SMART Domains Protein: ENSMUSP00000118881
Gene: ENSMUSG00000034593

DomainStartEndE-ValueType
coiled coil region 1 27 N/A INTRINSIC
coiled coil region 129 181 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000114803
Gene: ENSMUSG00000034593
AA Change: L189P

DomainStartEndE-ValueType
coiled coil region 95 201 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000136731
AA Change: L1406P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120444
Gene: ENSMUSG00000034593
AA Change: L1406P

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1314 1418 N/A INTRINSIC
DIL 1660 1765 2.47e-51 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000148144
AA Change: L163P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121158
Gene: ENSMUSG00000034593
AA Change: L163P

DomainStartEndE-ValueType
coiled coil region 71 175 N/A INTRINSIC
Blast:DIL 275 305 4e-13 BLAST
Blast:DIL 330 355 5e-6 BLAST
DIL 417 522 2.47e-51 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000155282
AA Change: L1433P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117493
Gene: ENSMUSG00000034593
AA Change: L1433P

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1339 1445 N/A INTRINSIC
DIL 1687 1792 2.47e-51 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three myosin V heavy-chain genes, belonging to the myosin gene superfamily. Myosin V is a class of actin-based motor proteins involved in cytoplasmic vesicle transport and anchorage, spindle-pole alignment and mRNA translocation. The protein encoded by this gene is abundant in melanocytes and nerve cells. Mutations in this gene cause Griscelli syndrome type-1 (GS1), Griscelli syndrome type-3 (GS3) and neuroectodermal melanolysosomal disease, or Elejalde disease. Multiple alternatively spliced transcript variants encoding different isoforms have been reported, but the full-length nature of some variants has not been determined. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mutations in this gene result in diluted coat color, behavioral deficits including opisthotonus, and postnatal or premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 T A 15: 91,075,379 (GRCm39) I145F probably benign Het
Acvr2b T A 9: 119,262,352 (GRCm39) V455E probably benign Het
Adgrv1 A T 13: 81,588,344 (GRCm39) V4414E possibly damaging Het
Agap2 T C 10: 126,926,834 (GRCm39) V977A probably damaging Het
Aph1b A C 9: 66,701,401 (GRCm39) S79A probably damaging Het
Atm G A 9: 53,423,191 (GRCm39) S645L probably benign Het
Cdh11 T C 8: 103,400,456 (GRCm39) R171G probably benign Het
Ces2f T A 8: 105,681,330 (GRCm39) D556E probably benign Het
Cfap210 A C 2: 69,588,792 (GRCm39) N439K probably benign Het
Cyp26b1 C A 6: 84,553,964 (GRCm39) V218L possibly damaging Het
Diaph1 T C 18: 38,028,353 (GRCm39) probably null Het
Dock1 A G 7: 134,367,003 (GRCm39) I482V probably benign Het
Dok4 A T 8: 95,594,053 (GRCm39) D47E possibly damaging Het
Dqx1 T A 6: 83,036,028 (GRCm39) L120Q probably damaging Het
Duxf3 A T 10: 58,066,558 (GRCm39) V157E probably damaging Het
Efcab3 T C 11: 104,653,516 (GRCm39) probably null Het
Eif2a C A 3: 58,456,102 (GRCm39) P367Q probably damaging Het
Elp2 C T 18: 24,744,985 (GRCm39) R102C probably damaging Het
Erich2 T C 2: 70,364,666 (GRCm39) S347P probably damaging Het
Fgfr3 GGACCTCTCCGTG GG 5: 33,892,766 (GRCm39) probably null Het
Flacc1 T A 1: 58,717,467 (GRCm39) D148V probably damaging Het
Gadl1 A T 9: 115,903,155 (GRCm39) I495L probably benign Het
Gcnt4 A G 13: 97,083,468 (GRCm39) T255A possibly damaging Het
Gm10972 A G 3: 94,550,887 (GRCm39) K21E unknown Het
Gm57859 T A 11: 113,583,223 (GRCm39) W517R probably damaging Het
Gm7361 C A 5: 26,466,188 (GRCm39) H183Q probably benign Het
Gp2 C T 7: 119,053,829 (GRCm39) C44Y probably damaging Het
Hcar2 C T 5: 124,003,249 (GRCm39) V85I probably benign Het
Hira T C 16: 18,770,829 (GRCm39) V822A probably damaging Het
Ighv1-5 T A 12: 114,477,156 (GRCm39) T49S probably damaging Het
Ints1 C T 5: 139,754,731 (GRCm39) V603M probably damaging Het
Kdm2a A C 19: 4,374,404 (GRCm39) L909R probably damaging Het
Klkb1 T A 8: 45,747,827 (GRCm39) probably benign Het
Krit1 A G 5: 3,862,349 (GRCm39) H168R possibly damaging Het
Map3k21 A T 8: 126,654,340 (GRCm39) E386D probably damaging Het
Muc16 C T 9: 18,556,385 (GRCm39) E3303K unknown Het
Muc5b T G 7: 141,415,250 (GRCm39) V2732G possibly damaging Het
Nlrc5 T C 8: 95,248,598 (GRCm39) L1740S probably damaging Het
Nolc1 A G 19: 46,071,257 (GRCm39) K402R probably benign Het
Or4b1b T A 2: 90,112,098 (GRCm39) T274S possibly damaging Het
Or4k15 T A 14: 50,364,952 (GRCm39) L306Q probably benign Het
Or52s19 T C 7: 103,008,219 (GRCm39) M61V probably damaging Het
Or8u8 T C 2: 86,012,417 (GRCm39) I13V probably benign Het
Pnma8b A G 7: 16,678,874 (GRCm39) probably benign Het
Pnpt1 A T 11: 29,080,860 (GRCm39) M35L probably benign Het
Postn A G 3: 54,270,091 (GRCm39) K57E probably damaging Het
Ppp1r9a A C 6: 4,905,775 (GRCm39) D110A probably damaging Het
Pptc7 G A 5: 122,422,942 (GRCm39) V71M possibly damaging Het
Prdm11 T A 2: 92,843,052 (GRCm39) I136F possibly damaging Het
Rfc1 A G 5: 65,436,841 (GRCm39) L613P probably damaging Het
Ryr3 T C 2: 112,560,818 (GRCm39) D2981G probably benign Het
Sbf2 C A 7: 110,213,923 (GRCm39) E16* probably null Het
Scara3 T C 14: 66,168,651 (GRCm39) E322G probably damaging Het
Sema5b T A 16: 35,481,700 (GRCm39) C893S probably damaging Het
Setdb1 T C 3: 95,249,139 (GRCm39) D323G probably damaging Het
Slc19a3 T C 1: 82,991,649 (GRCm39) Y453C probably damaging Het
Snx5 T C 2: 144,099,894 (GRCm39) K137E probably damaging Het
Taar8c G A 10: 23,977,116 (GRCm39) T232I probably benign Het
Taok2 G A 7: 126,474,050 (GRCm39) T352I probably damaging Het
Ttc3 C A 16: 94,219,541 (GRCm39) R489S possibly damaging Het
Usp12 A T 5: 146,689,264 (GRCm39) probably null Het
Usp16 T A 16: 87,263,174 (GRCm39) C125* probably null Het
Vmn2r106 C T 17: 20,488,201 (GRCm39) E733K probably damaging Het
Vps13b T A 15: 35,876,843 (GRCm39) I2832K probably benign Het
Vps13c A G 9: 67,747,761 (GRCm39) Y18C probably damaging Het
Zfp160 T A 17: 21,246,455 (GRCm39) I335K probably benign Het
Zfp788 A T 7: 41,298,275 (GRCm39) I304F possibly damaging Het
Other mutations in Myo5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Myo5a APN 9 75,068,779 (GRCm39) nonsense probably null
IGL00547:Myo5a APN 9 75,048,735 (GRCm39) missense probably benign 0.00
IGL00788:Myo5a APN 9 75,076,241 (GRCm39) missense probably benign 0.15
IGL01327:Myo5a APN 9 75,094,820 (GRCm39) splice site probably benign
IGL01687:Myo5a APN 9 75,063,531 (GRCm39) missense probably benign 0.12
IGL01886:Myo5a APN 9 75,076,372 (GRCm39) splice site probably benign
IGL01945:Myo5a APN 9 75,047,953 (GRCm39) missense probably damaging 1.00
IGL02127:Myo5a APN 9 75,120,263 (GRCm39) missense probably benign 0.12
IGL02137:Myo5a APN 9 75,068,817 (GRCm39) splice site probably null
IGL02183:Myo5a APN 9 75,074,518 (GRCm39) splice site probably benign
IGL02427:Myo5a APN 9 75,083,900 (GRCm39) splice site probably benign
IGL02490:Myo5a APN 9 75,043,737 (GRCm39) missense probably damaging 1.00
IGL02574:Myo5a APN 9 75,118,429 (GRCm39) missense probably benign 0.00
IGL02886:Myo5a APN 9 75,059,169 (GRCm39) splice site probably benign
IGL02961:Myo5a APN 9 75,122,402 (GRCm39) missense probably benign 0.04
IGL03090:Myo5a APN 9 75,028,115 (GRCm39) missense probably damaging 1.00
IGL03119:Myo5a APN 9 75,081,297 (GRCm39) missense probably benign 0.01
IGL03237:Myo5a APN 9 75,037,276 (GRCm39) missense probably damaging 1.00
IGL03296:Myo5a APN 9 75,023,484 (GRCm39) missense probably damaging 1.00
naoki UTSW 9 75,068,774 (GRCm39) missense probably damaging 1.00
new_gray UTSW 9 0 () missense
nut UTSW 9 0 () splice donor site
silver_decerebrate UTSW 9 75,071,477 (GRCm39) missense probably damaging 1.00
silver_decerebrate_2 UTSW 9 75,118,408 (GRCm39) missense probably damaging 1.00
IGL02988:Myo5a UTSW 9 75,037,423 (GRCm39) splice site probably benign
IGL03050:Myo5a UTSW 9 75,054,191 (GRCm39) splice site probably null
PIT4403001:Myo5a UTSW 9 75,124,805 (GRCm39) missense probably damaging 1.00
R0047:Myo5a UTSW 9 75,063,489 (GRCm39) missense probably damaging 1.00
R0047:Myo5a UTSW 9 75,063,489 (GRCm39) missense probably damaging 1.00
R0091:Myo5a UTSW 9 75,068,774 (GRCm39) missense probably damaging 1.00
R0142:Myo5a UTSW 9 75,067,856 (GRCm39) missense probably benign 0.01
R0243:Myo5a UTSW 9 75,093,405 (GRCm39) critical splice donor site probably null
R0395:Myo5a UTSW 9 75,101,259 (GRCm39) missense probably benign 0.39
R0427:Myo5a UTSW 9 75,081,478 (GRCm39) missense probably benign 0.00
R0545:Myo5a UTSW 9 75,074,319 (GRCm39) missense possibly damaging 0.94
R0565:Myo5a UTSW 9 75,087,394 (GRCm39) missense probably benign 0.00
R0601:Myo5a UTSW 9 75,081,297 (GRCm39) missense probably benign 0.01
R1457:Myo5a UTSW 9 75,120,347 (GRCm39) missense probably damaging 0.99
R1510:Myo5a UTSW 9 75,078,833 (GRCm39) missense probably benign
R1548:Myo5a UTSW 9 75,079,028 (GRCm39) missense probably damaging 1.00
R1759:Myo5a UTSW 9 75,089,275 (GRCm39) missense possibly damaging 0.72
R1924:Myo5a UTSW 9 75,023,489 (GRCm39) missense probably damaging 1.00
R1960:Myo5a UTSW 9 75,055,139 (GRCm39) missense probably damaging 1.00
R2050:Myo5a UTSW 9 75,054,156 (GRCm39) missense probably benign 0.01
R2070:Myo5a UTSW 9 75,089,266 (GRCm39) missense probably benign 0.03
R2075:Myo5a UTSW 9 75,097,200 (GRCm39) missense probably benign 0.01
R2148:Myo5a UTSW 9 75,087,429 (GRCm39) missense probably damaging 1.00
R2201:Myo5a UTSW 9 75,125,225 (GRCm39) missense possibly damaging 0.51
R2337:Myo5a UTSW 9 75,111,083 (GRCm39) missense probably damaging 1.00
R2357:Myo5a UTSW 9 75,108,647 (GRCm39) missense probably damaging 0.99
R2392:Myo5a UTSW 9 75,116,521 (GRCm39) missense probably benign 0.02
R2432:Myo5a UTSW 9 75,120,155 (GRCm39) missense possibly damaging 0.89
R2568:Myo5a UTSW 9 75,059,179 (GRCm39) missense probably damaging 1.00
R2568:Myo5a UTSW 9 75,030,322 (GRCm39) missense probably damaging 1.00
R2932:Myo5a UTSW 9 75,103,418 (GRCm39) missense possibly damaging 0.85
R2971:Myo5a UTSW 9 75,023,484 (GRCm39) missense probably damaging 1.00
R4231:Myo5a UTSW 9 75,097,279 (GRCm39) missense possibly damaging 0.67
R4293:Myo5a UTSW 9 75,051,453 (GRCm39) missense probably benign
R4321:Myo5a UTSW 9 75,124,812 (GRCm39) missense probably damaging 0.99
R4450:Myo5a UTSW 9 75,074,458 (GRCm39) missense probably benign 0.00
R4573:Myo5a UTSW 9 75,108,579 (GRCm39) splice site probably null
R4577:Myo5a UTSW 9 75,124,827 (GRCm39) missense probably damaging 1.00
R4601:Myo5a UTSW 9 75,043,670 (GRCm39) missense probably damaging 1.00
R4690:Myo5a UTSW 9 75,061,105 (GRCm39) missense probably damaging 0.99
R4691:Myo5a UTSW 9 75,087,438 (GRCm39) missense probably damaging 0.99
R4764:Myo5a UTSW 9 75,023,618 (GRCm39) intron probably benign
R4767:Myo5a UTSW 9 75,051,358 (GRCm39) missense probably damaging 0.99
R4811:Myo5a UTSW 9 75,048,825 (GRCm39) critical splice donor site probably null
R4829:Myo5a UTSW 9 75,043,689 (GRCm39) missense probably damaging 1.00
R4863:Myo5a UTSW 9 75,124,789 (GRCm39) missense probably damaging 1.00
R4902:Myo5a UTSW 9 75,081,360 (GRCm39) missense probably benign
R4947:Myo5a UTSW 9 75,030,330 (GRCm39) missense probably damaging 1.00
R5074:Myo5a UTSW 9 75,081,438 (GRCm39) missense probably benign
R5095:Myo5a UTSW 9 75,091,671 (GRCm39) nonsense probably null
R5095:Myo5a UTSW 9 75,059,302 (GRCm39) missense probably damaging 1.00
R5254:Myo5a UTSW 9 75,037,402 (GRCm39) missense probably damaging 1.00
R5267:Myo5a UTSW 9 75,059,292 (GRCm39) missense probably damaging 1.00
R5419:Myo5a UTSW 9 75,055,179 (GRCm39) missense probably damaging 1.00
R5514:Myo5a UTSW 9 75,061,048 (GRCm39) missense probably damaging 1.00
R5629:Myo5a UTSW 9 75,111,127 (GRCm39) missense possibly damaging 0.89
R5649:Myo5a UTSW 9 75,079,001 (GRCm39) missense possibly damaging 0.92
R5661:Myo5a UTSW 9 75,074,488 (GRCm39) missense probably benign 0.02
R5665:Myo5a UTSW 9 75,051,463 (GRCm39) critical splice donor site probably null
R5719:Myo5a UTSW 9 75,059,213 (GRCm39) missense probably damaging 1.00
R5964:Myo5a UTSW 9 75,111,115 (GRCm39) missense probably benign 0.09
R6014:Myo5a UTSW 9 75,074,489 (GRCm39) nonsense probably null
R6344:Myo5a UTSW 9 75,067,791 (GRCm39) missense probably benign 0.09
R6345:Myo5a UTSW 9 75,097,195 (GRCm39) missense possibly damaging 0.77
R6644:Myo5a UTSW 9 75,054,249 (GRCm39) missense probably damaging 0.98
R6712:Myo5a UTSW 9 75,120,182 (GRCm39) missense probably benign 0.12
R6838:Myo5a UTSW 9 75,061,165 (GRCm39) critical splice donor site probably null
R6866:Myo5a UTSW 9 75,047,970 (GRCm39) missense probably damaging 1.00
R6876:Myo5a UTSW 9 75,067,772 (GRCm39) missense probably benign 0.04
R7108:Myo5a UTSW 9 75,037,274 (GRCm39) missense probably damaging 1.00
R7159:Myo5a UTSW 9 75,078,845 (GRCm39) missense probably benign 0.07
R7164:Myo5a UTSW 9 75,087,435 (GRCm39) missense probably benign 0.00
R7219:Myo5a UTSW 9 75,028,052 (GRCm39) missense probably damaging 1.00
R7620:Myo5a UTSW 9 75,071,418 (GRCm39) missense probably benign 0.41
R7719:Myo5a UTSW 9 75,051,366 (GRCm39) missense probably benign 0.01
R7810:Myo5a UTSW 9 75,076,292 (GRCm39) missense probably benign
R7810:Myo5a UTSW 9 75,067,747 (GRCm39) missense probably benign 0.09
R7866:Myo5a UTSW 9 75,111,034 (GRCm39) missense probably damaging 1.00
R7939:Myo5a UTSW 9 75,097,182 (GRCm39) missense
R8050:Myo5a UTSW 9 75,089,228 (GRCm39) missense probably damaging 0.99
R8061:Myo5a UTSW 9 75,030,239 (GRCm39) nonsense probably null
R8326:Myo5a UTSW 9 75,125,271 (GRCm39) missense probably damaging 0.98
R8529:Myo5a UTSW 9 75,120,154 (GRCm39) missense probably benign 0.02
R8824:Myo5a UTSW 9 75,074,328 (GRCm39) missense probably damaging 1.00
R8858:Myo5a UTSW 9 75,091,965 (GRCm39) missense probably damaging 0.99
R9040:Myo5a UTSW 9 75,081,341 (GRCm39) missense probably benign 0.07
R9092:Myo5a UTSW 9 75,054,414 (GRCm39) critical splice donor site probably null
R9249:Myo5a UTSW 9 75,097,279 (GRCm39) missense possibly damaging 0.67
R9274:Myo5a UTSW 9 75,097,279 (GRCm39) missense possibly damaging 0.67
R9293:Myo5a UTSW 9 75,087,312 (GRCm39) missense probably benign 0.37
R9366:Myo5a UTSW 9 75,124,800 (GRCm39) missense probably damaging 0.98
R9410:Myo5a UTSW 9 75,023,496 (GRCm39) missense probably damaging 0.98
R9644:Myo5a UTSW 9 75,043,631 (GRCm39) missense probably damaging 1.00
R9649:Myo5a UTSW 9 75,099,726 (GRCm39) missense
R9748:Myo5a UTSW 9 75,091,965 (GRCm39) missense probably damaging 0.99
R9766:Myo5a UTSW 9 75,078,914 (GRCm39) missense probably damaging 0.99
X0010:Myo5a UTSW 9 75,093,187 (GRCm39) missense probably damaging 1.00
Z1177:Myo5a UTSW 9 75,093,318 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- CCACCTGCAGCTTTTATGTG -3'
(R):5'- ACTCTGGCATGTGTTAGCTG -3'

Sequencing Primer
(F):5'- TGTGAAACTAACAGTGTGTTGC -3'
(R):5'- CATAGAAGAATTTTTCATTCCGCAG -3'
Posted On 2019-10-17