Incidental Mutation 'R7497:Gadl1'
ID581149
Institutional Source Beutler Lab
Gene Symbol Gadl1
Ensembl Gene ENSMUSG00000056880
Gene Nameglutamate decarboxylase-like 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R7497 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location115909455-116076176 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 116074087 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 495 (I495L)
Ref Sequence ENSEMBL: ENSMUSP00000077694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069651] [ENSMUST00000121770]
Predicted Effect probably benign
Transcript: ENSMUST00000069651
AA Change: I495L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000077694
Gene: ENSMUSG00000056880
AA Change: I495L

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 58 426 1.1e-113 PFAM
Pfam:Beta_elim_lyase 137 467 1e-7 PFAM
Pfam:Aminotran_5 167 333 1.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121770
AA Change: I495L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000113240
Gene: ENSMUSG00000056880
AA Change: I495L

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 58 426 2.8e-112 PFAM
Pfam:Beta_elim_lyase 137 461 6.2e-8 PFAM
Pfam:Aminotran_5 184 330 4.1e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (70/70)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 T A 15: 91,191,176 I145F probably benign Het
Acvr2b T A 9: 119,433,286 V455E probably benign Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Agap2 T C 10: 127,090,965 V977A probably damaging Het
Als2cr12 T A 1: 58,678,308 D148V probably damaging Het
Aph1b A C 9: 66,794,119 S79A probably damaging Het
Atm G A 9: 53,511,891 S645L probably benign Het
Ccdc173 A C 2: 69,758,448 N439K probably benign Het
Cdh11 T C 8: 102,673,824 R171G probably benign Het
Ces2f T A 8: 104,954,698 D556E probably benign Het
Cyp26b1 C A 6: 84,576,982 V218L possibly damaging Het
D11Wsu47e T A 11: 113,692,397 W517R probably damaging Het
Diaph1 T C 18: 37,895,300 probably null Het
Dock1 A G 7: 134,765,274 I482V probably benign Het
Dok4 A T 8: 94,867,425 D47E possibly damaging Het
Dqx1 T A 6: 83,059,047 L120Q probably damaging Het
Duxf3 A T 10: 58,230,736 V157E probably damaging Het
Eif2a C A 3: 58,548,681 P367Q probably damaging Het
Elp2 C T 18: 24,611,928 R102C probably damaging Het
Erich2 T C 2: 70,534,322 S347P probably damaging Het
Fgfr3 GGACCTCTCCGTG GG 5: 33,735,422 probably null Het
Gcnt4 A G 13: 96,946,960 T255A possibly damaging Het
Gm10972 A G 3: 94,643,580 K21E unknown Het
Gm11639 T C 11: 104,762,690 probably null Het
Gm7361 C A 5: 26,261,190 H183Q probably benign Het
Gp2 C T 7: 119,454,606 C44Y probably damaging Het
Hcar2 C T 5: 123,865,186 V85I probably benign Het
Hira T C 16: 18,952,079 V822A probably damaging Het
Ighv1-5 T A 12: 114,513,536 T49S probably damaging Het
Ints1 C T 5: 139,768,976 V603M probably damaging Het
Kdm2a A C 19: 4,324,376 L909R probably damaging Het
Klkb1 T A 8: 45,294,790 probably benign Het
Krit1 A G 5: 3,812,349 H168R possibly damaging Het
Map3k21 A T 8: 125,927,601 E386D probably damaging Het
Muc16 C T 9: 18,645,089 E3303K unknown Het
Muc5b T G 7: 141,861,513 V2732G possibly damaging Het
Myo5a T C 9: 75,197,701 L189P Het
Nlrc5 T C 8: 94,521,970 L1740S probably damaging Het
Nolc1 A G 19: 46,082,818 K402R probably benign Het
Olfr1272 T A 2: 90,281,754 T274S possibly damaging Het
Olfr52 T C 2: 86,182,073 I13V probably benign Het
Olfr601 T C 7: 103,359,012 M61V probably damaging Het
Olfr727 T A 14: 50,127,495 L306Q probably benign Het
Pnmal2 A G 7: 16,944,949 probably benign Het
Pnpt1 A T 11: 29,130,860 M35L probably benign Het
Postn A G 3: 54,362,670 K57E probably damaging Het
Ppp1r9a A C 6: 4,905,775 D110A probably damaging Het
Pptc7 G A 5: 122,284,879 V71M possibly damaging Het
Prdm11 T A 2: 93,012,707 I136F possibly damaging Het
Rfc1 A G 5: 65,279,498 L613P probably damaging Het
Ryr3 T C 2: 112,730,473 D2981G probably benign Het
Sbf2 C A 7: 110,614,716 E16* probably null Het
Scara3 T C 14: 65,931,202 E322G probably damaging Het
Sema5b T A 16: 35,661,330 C893S probably damaging Het
Setdb1 T C 3: 95,341,828 D323G probably damaging Het
Slc19a3 T C 1: 83,013,928 Y453C probably damaging Het
Snx5 T C 2: 144,257,974 K137E probably damaging Het
Taar8c G A 10: 24,101,218 T232I probably benign Het
Taok2 G A 7: 126,874,878 T352I probably damaging Het
Ttc3 C A 16: 94,418,682 R489S possibly damaging Het
Usp12 A T 5: 146,752,454 probably null Het
Usp16 T A 16: 87,466,286 C125* probably null Het
Vmn2r106 C T 17: 20,267,939 E733K probably damaging Het
Vps13b T A 15: 35,876,697 I2832K probably benign Het
Vps13c A G 9: 67,840,479 Y18C probably damaging Het
Zfp160 T A 17: 21,026,193 I335K probably benign Het
Zfp788 A T 7: 41,648,851 I304F possibly damaging Het
Other mutations in Gadl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Gadl1 APN 9 115954839 critical splice donor site probably null
IGL01343:Gadl1 APN 9 116074112 makesense probably null
IGL01693:Gadl1 APN 9 115949585 missense probably damaging 1.00
IGL02106:Gadl1 APN 9 115937157 utr 5 prime probably benign
IGL02740:Gadl1 APN 9 116006561 nonsense probably null
IGL03063:Gadl1 APN 9 115966267 missense probably damaging 1.00
IGL03104:Gadl1 APN 9 116074040 missense possibly damaging 0.93
IGL03127:Gadl1 APN 9 115948664 missense probably damaging 1.00
R0133:Gadl1 UTSW 9 115941343 missense probably benign 0.00
R0285:Gadl1 UTSW 9 116030738 splice site probably benign
R0737:Gadl1 UTSW 9 116073987 missense probably damaging 0.99
R0771:Gadl1 UTSW 9 115944232 missense probably damaging 1.00
R1522:Gadl1 UTSW 9 115944229 missense probably damaging 1.00
R1716:Gadl1 UTSW 9 116006508 nonsense probably null
R2061:Gadl1 UTSW 9 115941380 missense probably damaging 1.00
R2163:Gadl1 UTSW 9 115949558 missense possibly damaging 0.93
R3854:Gadl1 UTSW 9 116006664 nonsense probably null
R3964:Gadl1 UTSW 9 115965608 missense probably damaging 0.98
R4654:Gadl1 UTSW 9 115941340 missense probably damaging 1.00
R4724:Gadl1 UTSW 9 115954617 missense possibly damaging 0.81
R4765:Gadl1 UTSW 9 115966313 missense probably null 0.00
R4956:Gadl1 UTSW 9 116040919 missense probably benign 0.00
R5179:Gadl1 UTSW 9 115960380 nonsense probably null
R5593:Gadl1 UTSW 9 116006650 missense probably damaging 1.00
R5620:Gadl1 UTSW 9 115937162 start codon destroyed probably benign 0.09
R6048:Gadl1 UTSW 9 116006701 splice site probably null
R6458:Gadl1 UTSW 9 116041002 makesense probably null
R7889:Gadl1 UTSW 9 115954815 missense possibly damaging 0.56
Z1088:Gadl1 UTSW 9 115937270 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCGGCCATACGGTTTCATCC -3'
(R):5'- TTTCTCCATGATACAAACAGCAGC -3'

Sequencing Primer
(F):5'- GGCCATACGGTTTCATCCATGTC -3'
(R):5'- AGAGCCCTTAGGACTATTTGC -3'
Posted On2019-10-17