Incidental Mutation 'R7497:Acvr2b'
ID 581150
Institutional Source Beutler Lab
Gene Symbol Acvr2b
Ensembl Gene ENSMUSG00000061393
Gene Name activin receptor IIB
Synonyms ActRIIB
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7497 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 119402118-119434995 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 119433286 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 455 (V455E)
Ref Sequence ENSEMBL: ENSMUSP00000150566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035093] [ENSMUST00000165044] [ENSMUST00000215746]
AlphaFold P27040
Predicted Effect probably benign
Transcript: ENSMUST00000035093
AA Change: V471E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000035093
Gene: ENSMUSG00000061393
AA Change: V471E

DomainStartEndE-ValueType
Pfam:Activin_recp 27 117 5.4e-13 PFAM
transmembrane domain 130 152 N/A INTRINSIC
Pfam:Pkinase 206 494 1.5e-55 PFAM
Pfam:Pkinase_Tyr 206 494 2.3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165044
AA Change: V479E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126108
Gene: ENSMUSG00000061393
AA Change: V479E

DomainStartEndE-ValueType
Pfam:Activin_recp 27 117 5.3e-14 PFAM
transmembrane domain 138 160 N/A INTRINSIC
Pfam:Pkinase_Tyr 214 502 1.7e-26 PFAM
Pfam:Pkinase 217 501 1e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215746
AA Change: V455E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Activins are dimeric growth and differentiation factors which belong to the transforming growth factor-beta (TGF-beta) superfamily of structurally related signaling proteins. Activins signal through a heteromeric complex of receptor serine kinases which include at least two type I (I and IB) and two type II (II and IIB) receptors. These receptors are all transmembrane proteins, composed of a ligand-binding extracellular domain with cysteine-rich region, a transmembrane domain, and a cytoplasmic domain with predicted serine/threonine specificity. Type I receptors are essential for signaling; and type II receptors are required for binding ligands and for expression of type I receptors. Type I and II receptors form a stable complex after ligand binding, resulting in phosphorylation of type I receptors by type II receptors. Type II receptors are considered to be constitutively active kinases. This gene encodes activin A type IIB receptor, which displays a 3- to 4-fold higher affinity for the ligand than activin A type II receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene show abnormal lateral asymmetry and homeotic transformation of the axial skeleton, and die shortly after birth with extensive cardiac defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 T A 15: 91,191,176 I145F probably benign Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Agap2 T C 10: 127,090,965 V977A probably damaging Het
Als2cr12 T A 1: 58,678,308 D148V probably damaging Het
Aph1b A C 9: 66,794,119 S79A probably damaging Het
Atm G A 9: 53,511,891 S645L probably benign Het
Ccdc173 A C 2: 69,758,448 N439K probably benign Het
Cdh11 T C 8: 102,673,824 R171G probably benign Het
Ces2f T A 8: 104,954,698 D556E probably benign Het
Cyp26b1 C A 6: 84,576,982 V218L possibly damaging Het
D11Wsu47e T A 11: 113,692,397 W517R probably damaging Het
Diaph1 T C 18: 37,895,300 probably null Het
Dock1 A G 7: 134,765,274 I482V probably benign Het
Dok4 A T 8: 94,867,425 D47E possibly damaging Het
Dqx1 T A 6: 83,059,047 L120Q probably damaging Het
Duxf3 A T 10: 58,230,736 V157E probably damaging Het
Eif2a C A 3: 58,548,681 P367Q probably damaging Het
Elp2 C T 18: 24,611,928 R102C probably damaging Het
Erich2 T C 2: 70,534,322 S347P probably damaging Het
Fgfr3 GGACCTCTCCGTG GG 5: 33,735,422 probably null Het
Gadl1 A T 9: 116,074,087 I495L probably benign Het
Gcnt4 A G 13: 96,946,960 T255A possibly damaging Het
Gm10972 A G 3: 94,643,580 K21E unknown Het
Gm11639 T C 11: 104,762,690 probably null Het
Gm7361 C A 5: 26,261,190 H183Q probably benign Het
Gp2 C T 7: 119,454,606 C44Y probably damaging Het
Hcar2 C T 5: 123,865,186 V85I probably benign Het
Hira T C 16: 18,952,079 V822A probably damaging Het
Ighv1-5 T A 12: 114,513,536 T49S probably damaging Het
Ints1 C T 5: 139,768,976 V603M probably damaging Het
Kdm2a A C 19: 4,324,376 L909R probably damaging Het
Klkb1 T A 8: 45,294,790 probably benign Het
Krit1 A G 5: 3,812,349 H168R possibly damaging Het
Map3k21 A T 8: 125,927,601 E386D probably damaging Het
Muc16 C T 9: 18,645,089 E3303K unknown Het
Muc5b T G 7: 141,861,513 V2732G possibly damaging Het
Myo5a T C 9: 75,197,701 L189P Het
Nlrc5 T C 8: 94,521,970 L1740S probably damaging Het
Nolc1 A G 19: 46,082,818 K402R probably benign Het
Olfr1272 T A 2: 90,281,754 T274S possibly damaging Het
Olfr52 T C 2: 86,182,073 I13V probably benign Het
Olfr601 T C 7: 103,359,012 M61V probably damaging Het
Olfr727 T A 14: 50,127,495 L306Q probably benign Het
Pnmal2 A G 7: 16,944,949 probably benign Het
Pnpt1 A T 11: 29,130,860 M35L probably benign Het
Postn A G 3: 54,362,670 K57E probably damaging Het
Ppp1r9a A C 6: 4,905,775 D110A probably damaging Het
Pptc7 G A 5: 122,284,879 V71M possibly damaging Het
Prdm11 T A 2: 93,012,707 I136F possibly damaging Het
Rfc1 A G 5: 65,279,498 L613P probably damaging Het
Ryr3 T C 2: 112,730,473 D2981G probably benign Het
Sbf2 C A 7: 110,614,716 E16* probably null Het
Scara3 T C 14: 65,931,202 E322G probably damaging Het
Sema5b T A 16: 35,661,330 C893S probably damaging Het
Setdb1 T C 3: 95,341,828 D323G probably damaging Het
Slc19a3 T C 1: 83,013,928 Y453C probably damaging Het
Snx5 T C 2: 144,257,974 K137E probably damaging Het
Taar8c G A 10: 24,101,218 T232I probably benign Het
Taok2 G A 7: 126,874,878 T352I probably damaging Het
Ttc3 C A 16: 94,418,682 R489S possibly damaging Het
Usp12 A T 5: 146,752,454 probably null Het
Usp16 T A 16: 87,466,286 C125* probably null Het
Vmn2r106 C T 17: 20,267,939 E733K probably damaging Het
Vps13b T A 15: 35,876,697 I2832K probably benign Het
Vps13c A G 9: 67,840,479 Y18C probably damaging Het
Zfp160 T A 17: 21,026,193 I335K probably benign Het
Zfp788 A T 7: 41,648,851 I304F possibly damaging Het
Other mutations in Acvr2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01662:Acvr2b APN 9 119432504 missense probably damaging 1.00
IGL02206:Acvr2b APN 9 119427998 nonsense probably null
IGL03022:Acvr2b APN 9 119427521 missense probably benign 0.10
IGL03131:Acvr2b APN 9 119431284 missense possibly damaging 0.92
R0455:Acvr2b UTSW 9 119432609 missense probably damaging 1.00
R2131:Acvr2b UTSW 9 119432808 missense probably damaging 1.00
R4744:Acvr2b UTSW 9 119431262 missense probably damaging 1.00
R5278:Acvr2b UTSW 9 119432489 missense probably damaging 0.99
R5636:Acvr2b UTSW 9 119428309 missense probably damaging 1.00
R6196:Acvr2b UTSW 9 119433403 missense possibly damaging 0.71
R6253:Acvr2b UTSW 9 119428561 missense probably damaging 1.00
R6424:Acvr2b UTSW 9 119402579 missense probably benign
R6465:Acvr2b UTSW 9 119433303 missense probably damaging 1.00
R7096:Acvr2b UTSW 9 119428189 splice site probably null
R7102:Acvr2b UTSW 9 119432553 missense probably damaging 0.96
R8557:Acvr2b UTSW 9 119432588 missense probably damaging 0.98
R9041:Acvr2b UTSW 9 119427986 nonsense probably null
R9149:Acvr2b UTSW 9 119428050 missense probably damaging 1.00
R9276:Acvr2b UTSW 9 119402550 missense probably benign 0.23
R9321:Acvr2b UTSW 9 119428285 missense probably benign 0.01
R9340:Acvr2b UTSW 9 119428426 missense probably damaging 0.98
R9531:Acvr2b UTSW 9 119431326 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTGAACATTCTCCTGGACTGG -3'
(R):5'- AGATCCACTGAGTCTGGAGAG -3'

Sequencing Primer
(F):5'- CTGGGAGGAGAGGGGTCTC -3'
(R):5'- TCTGGAGAGACGCTACGTG -3'
Posted On 2019-10-17