Incidental Mutation 'R0633:Rtn3'
ID58116
Institutional Source Beutler Lab
Gene Symbol Rtn3
Ensembl Gene ENSMUSG00000024758
Gene Namereticulon 3
Synonyms
MMRRC Submission 038822-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.276) question?
Stock #R0633 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location7425901-7483289 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 7457593 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 326 (T326P)
Ref Sequence ENSEMBL: ENSMUSP00000085496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025667] [ENSMUST00000065304] [ENSMUST00000088169] [ENSMUST00000088171]
Predicted Effect probably benign
Transcript: ENSMUST00000025667
SMART Domains Protein: ENSMUSP00000025667
Gene: ENSMUSG00000024758

DomainStartEndE-ValueType
low complexity region 4 40 N/A INTRINSIC
Pfam:Reticulon 49 219 8.7e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000065304
AA Change: T345P

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000065810
Gene: ENSMUSG00000024758
AA Change: T345P

DomainStartEndE-ValueType
low complexity region 4 40 N/A INTRINSIC
low complexity region 42 66 N/A INTRINSIC
low complexity region 80 91 N/A INTRINSIC
low complexity region 119 131 N/A INTRINSIC
low complexity region 516 527 N/A INTRINSIC
low complexity region 639 650 N/A INTRINSIC
Pfam:Reticulon 776 940 9.1e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088169
SMART Domains Protein: ENSMUSP00000085494
Gene: ENSMUSG00000024758

DomainStartEndE-ValueType
low complexity region 4 40 N/A INTRINSIC
low complexity region 42 66 N/A INTRINSIC
Pfam:Reticulon 68 238 1.1e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088171
AA Change: T326P

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000085496
Gene: ENSMUSG00000024758
AA Change: T326P

DomainStartEndE-ValueType
low complexity region 4 56 N/A INTRINSIC
low complexity region 61 72 N/A INTRINSIC
low complexity region 100 112 N/A INTRINSIC
low complexity region 497 508 N/A INTRINSIC
low complexity region 620 631 N/A INTRINSIC
Pfam:Reticulon 757 927 1.8e-56 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the reticulon family of highly conserved genes that are preferentially expressed in neuroendocrine tissues. This family of proteins interact with, and modulate the activity of beta-amyloid converting enzyme 1 (BACE1), and the production of amyloid-beta. An increase in the expression of any reticulon protein substantially reduces the production of amyloid-beta, suggesting that reticulon proteins are negative modulators of BACE1 in cells. Alternatively spliced transcript variants encoding different isoforms have been found for this gene, and pseudogenes of this gene are located on chromosomes 4 and 12. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A T 6: 149,325,701 I82L probably benign Het
4921530L21Rik T G 14: 95,881,943 N45K probably damaging Het
4933408B17Rik A G 18: 34,586,266 V167A possibly damaging Het
Adamts8 A T 9: 30,943,511 R18S probably damaging Het
Adgb G A 10: 10,391,729 A923V probably benign Het
Aldh1a3 A G 7: 66,400,222 V416A probably damaging Het
Alox5 C T 6: 116,420,384 G280R probably damaging Het
Anapc5 A T 5: 122,800,632 Y360N probably damaging Het
Apbb1 C T 7: 105,558,963 V685I probably damaging Het
Apc2 C A 10: 80,307,455 A463E probably damaging Het
Arhgap21 C T 2: 20,855,387 W1170* probably null Het
Atat1 G A 17: 35,901,423 R305C probably damaging Het
Cars2 T C 8: 11,550,511 D56G probably benign Het
Cdc42bpb T C 12: 111,345,555 I108V probably damaging Het
Cftr T A 6: 18,305,980 I1255K probably damaging Het
Ckap5 T C 2: 91,550,743 L148P probably damaging Het
Cntn4 A G 6: 106,679,248 probably null Het
Cpe G A 8: 64,609,203 P273L probably damaging Het
Cpsf7 A G 19: 10,531,782 D19G probably benign Het
Ddx25 C A 9: 35,545,972 R349L probably damaging Het
Depdc7 T C 2: 104,722,881 D446G probably benign Het
Det1 T A 7: 78,843,935 N107I probably benign Het
Dock6 A T 9: 21,844,417 D170E probably benign Het
Dvl1 C T 4: 155,858,295 L673F probably damaging Het
Gucy1b1 A T 3: 82,045,460 I222K probably benign Het
Hfm1 T C 5: 106,917,601 T71A possibly damaging Het
Ikzf1 A G 11: 11,769,223 E310G probably damaging Het
Impg1 T C 9: 80,394,155 E163G possibly damaging Het
Itpr2 G T 6: 146,374,456 H426Q probably damaging Het
Itpripl2 C T 7: 118,490,256 G360D probably benign Het
Kif14 C T 1: 136,527,305 R1572C probably damaging Het
L3mbtl3 A T 10: 26,302,685 H568Q unknown Het
Lgi2 A G 5: 52,554,460 Y173H probably damaging Het
Lpar5 A C 6: 125,081,991 Y225S probably benign Het
Lpin3 A G 2: 160,903,974 H675R probably damaging Het
Lrp2 C A 2: 69,448,120 G3963V probably damaging Het
Man1a2 G T 3: 100,684,575 D13E possibly damaging Het
Map1a T C 2: 121,308,014 V2753A probably damaging Het
Mitf C A 6: 98,003,904 N97K probably damaging Het
Msh2 A G 17: 87,672,810 probably null Het
Msr1 T C 8: 39,620,000 E170G probably damaging Het
Myrip C A 9: 120,388,236 R79S probably damaging Het
Nek10 G A 14: 14,857,782 probably null Het
Neto1 C T 18: 86,404,729 R104* probably null Het
Nom1 A C 5: 29,451,100 K821T probably damaging Het
Nrxn1 A G 17: 90,704,181 V340A probably damaging Het
Nxpe4 A T 9: 48,396,597 I334F probably benign Het
Olfr1043 T A 2: 86,162,091 N286I probably damaging Het
Olfr1065 C T 2: 86,445,129 M284I probably benign Het
Olfr1247 T C 2: 89,609,374 M243V probably benign Het
Olfr1489 T C 19: 13,633,336 V75A probably damaging Het
Olfr382 A G 11: 73,516,927 S91P probably benign Het
Olfr705 T C 7: 106,713,977 K235E probably benign Het
Padi4 A G 4: 140,757,585 S322P probably damaging Het
Peli3 A G 19: 4,941,782 Y44H probably damaging Het
Prdm4 A G 10: 85,907,903 S163P probably damaging Het
Prom2 T C 2: 127,539,525 D227G probably benign Het
Ptgfr C T 3: 151,801,763 R321H probably benign Het
Rgs3 G A 4: 62,625,906 R136H probably damaging Het
Rgsl1 T G 1: 153,844,107 N3T possibly damaging Het
Rif1 T C 2: 52,112,563 S2010P probably benign Het
Rngtt T C 4: 33,368,690 F408L probably damaging Het
Slc18b1 A C 10: 23,806,038 M167L probably benign Het
Slc22a26 A G 19: 7,788,210 probably null Het
Slitrk6 T C 14: 110,751,885 D130G probably damaging Het
Snap47 A G 11: 59,428,613 V233A probably benign Het
Sumf1 A C 6: 108,144,671 Y158D probably damaging Het
Tbc1d15 A T 10: 115,220,310 H252Q probably benign Het
Thsd7b T C 1: 130,188,526 S1339P possibly damaging Het
Tmem45a2 T C 16: 57,049,414 I56V probably benign Het
Ttc21b A G 2: 66,236,233 S359P probably benign Het
Ttc27 T C 17: 74,729,977 I215T probably benign Het
Ttn C T 2: 76,724,195 V30759I possibly damaging Het
Vdac3 T C 8: 22,580,388 N168S probably damaging Het
Wdr7 T C 18: 63,865,300 V1106A probably benign Het
Wrap73 T A 4: 154,142,491 F16Y probably damaging Het
Zfat C A 15: 68,180,803 D381Y probably damaging Het
Other mutations in Rtn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Rtn3 APN 19 7435069 missense probably damaging 1.00
IGL01025:Rtn3 APN 19 7483041 missense unknown
IGL01347:Rtn3 APN 19 7457280 missense probably benign 0.01
IGL01845:Rtn3 APN 19 7457876 missense probably damaging 1.00
IGL02217:Rtn3 APN 19 7435084 missense probably damaging 0.99
IGL03024:Rtn3 APN 19 7483090 utr 5 prime probably benign
R0399:Rtn3 UTSW 19 7457876 missense probably damaging 1.00
R0826:Rtn3 UTSW 19 7467880 intron probably benign
R1327:Rtn3 UTSW 19 7431011 missense possibly damaging 0.81
R1735:Rtn3 UTSW 19 7457911 missense probably damaging 0.96
R2093:Rtn3 UTSW 19 7456850 missense probably damaging 1.00
R3116:Rtn3 UTSW 19 7431990 missense probably damaging 1.00
R3894:Rtn3 UTSW 19 7435085 missense probably damaging 1.00
R3961:Rtn3 UTSW 19 7458145 missense probably damaging 0.99
R3962:Rtn3 UTSW 19 7458145 missense probably damaging 0.99
R3963:Rtn3 UTSW 19 7458145 missense probably damaging 0.99
R4161:Rtn3 UTSW 19 7483079 missense probably benign 0.38
R4960:Rtn3 UTSW 19 7456521 missense probably damaging 1.00
R5585:Rtn3 UTSW 19 7458195 missense probably benign 0.12
R5735:Rtn3 UTSW 19 7456692 missense probably damaging 0.99
R5796:Rtn3 UTSW 19 7457467 missense possibly damaging 0.48
R5807:Rtn3 UTSW 19 7456827 missense probably damaging 1.00
R5864:Rtn3 UTSW 19 7435111 missense probably damaging 1.00
R6322:Rtn3 UTSW 19 7458138 missense possibly damaging 0.60
R6703:Rtn3 UTSW 19 7435045 missense probably damaging 1.00
R6885:Rtn3 UTSW 19 7458331 missense probably benign 0.31
R6888:Rtn3 UTSW 19 7457249 missense probably benign 0.00
R6989:Rtn3 UTSW 19 7456491 missense possibly damaging 0.95
R6992:Rtn3 UTSW 19 7435124 missense probably damaging 1.00
R7506:Rtn3 UTSW 19 7429753 missense probably benign 0.08
R7610:Rtn3 UTSW 19 7457929 missense probably damaging 1.00
R7639:Rtn3 UTSW 19 7457991 missense probably benign 0.01
R7909:Rtn3 UTSW 19 7456462 missense possibly damaging 0.67
R7915:Rtn3 UTSW 19 7457500 missense probably benign 0.06
R8088:Rtn3 UTSW 19 7434998 missense probably damaging 1.00
R8549:Rtn3 UTSW 19 7457259 missense probably benign 0.03
R8725:Rtn3 UTSW 19 7457361 missense probably benign
R8727:Rtn3 UTSW 19 7457361 missense probably benign
R8917:Rtn3 UTSW 19 7456740 missense possibly damaging 0.78
X0060:Rtn3 UTSW 19 7432571 missense possibly damaging 0.80
Z1192:Rtn3 UTSW 19 7482977 missense unknown
Predicted Primers PCR Primer
(F):5'- TTTCTCAGGCATAGAGCCAGGCAG -3'
(R):5'- TAAAGAGGCAGGGCGTTACCCATC -3'

Sequencing Primer
(F):5'- GAACTGAGGTAGTCTCTTACAGG -3'
(R):5'- CCTCTGTACTGCTCGGTAGAC -3'
Posted On2013-07-11