Incidental Mutation 'R7497:Or4k15'
ID 581160
Institutional Source Beutler Lab
Gene Symbol Or4k15
Ensembl Gene ENSMUSG00000059488
Gene Name olfactory receptor family 4 subfamily K member 15
Synonyms Olfr727, GA_x6K02T2PMLR-5817082-5818056, MOR246-2
MMRRC Submission 045570-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.140) question?
Stock # R7497 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 50364010-50365044 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 50364952 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 306 (L306Q)
Ref Sequence ENSEMBL: ENSMUSP00000149886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079142] [ENSMUST00000215317]
AlphaFold A2RTN7
Predicted Effect probably benign
Transcript: ENSMUST00000079142
AA Change: L306Q

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000078145
Gene: ENSMUSG00000059488
AA Change: L306Q

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 8.5e-49 PFAM
Pfam:7TM_GPCR_Srsx 36 290 1.5e-7 PFAM
Pfam:7tm_1 41 287 1.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215317
AA Change: L306Q

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.2180 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 T A 15: 91,075,379 (GRCm39) I145F probably benign Het
Acvr2b T A 9: 119,262,352 (GRCm39) V455E probably benign Het
Adgrv1 A T 13: 81,588,344 (GRCm39) V4414E possibly damaging Het
Agap2 T C 10: 126,926,834 (GRCm39) V977A probably damaging Het
Aph1b A C 9: 66,701,401 (GRCm39) S79A probably damaging Het
Atm G A 9: 53,423,191 (GRCm39) S645L probably benign Het
Cdh11 T C 8: 103,400,456 (GRCm39) R171G probably benign Het
Ces2f T A 8: 105,681,330 (GRCm39) D556E probably benign Het
Cfap210 A C 2: 69,588,792 (GRCm39) N439K probably benign Het
Cyp26b1 C A 6: 84,553,964 (GRCm39) V218L possibly damaging Het
Diaph1 T C 18: 38,028,353 (GRCm39) probably null Het
Dock1 A G 7: 134,367,003 (GRCm39) I482V probably benign Het
Dok4 A T 8: 95,594,053 (GRCm39) D47E possibly damaging Het
Dqx1 T A 6: 83,036,028 (GRCm39) L120Q probably damaging Het
Duxf3 A T 10: 58,066,558 (GRCm39) V157E probably damaging Het
Efcab3 T C 11: 104,653,516 (GRCm39) probably null Het
Eif2a C A 3: 58,456,102 (GRCm39) P367Q probably damaging Het
Elp2 C T 18: 24,744,985 (GRCm39) R102C probably damaging Het
Erich2 T C 2: 70,364,666 (GRCm39) S347P probably damaging Het
Fgfr3 GGACCTCTCCGTG GG 5: 33,892,766 (GRCm39) probably null Het
Flacc1 T A 1: 58,717,467 (GRCm39) D148V probably damaging Het
Gadl1 A T 9: 115,903,155 (GRCm39) I495L probably benign Het
Gcnt4 A G 13: 97,083,468 (GRCm39) T255A possibly damaging Het
Gm10972 A G 3: 94,550,887 (GRCm39) K21E unknown Het
Gm57859 T A 11: 113,583,223 (GRCm39) W517R probably damaging Het
Gm7361 C A 5: 26,466,188 (GRCm39) H183Q probably benign Het
Gp2 C T 7: 119,053,829 (GRCm39) C44Y probably damaging Het
Hcar2 C T 5: 124,003,249 (GRCm39) V85I probably benign Het
Hira T C 16: 18,770,829 (GRCm39) V822A probably damaging Het
Ighv1-5 T A 12: 114,477,156 (GRCm39) T49S probably damaging Het
Ints1 C T 5: 139,754,731 (GRCm39) V603M probably damaging Het
Kdm2a A C 19: 4,374,404 (GRCm39) L909R probably damaging Het
Klkb1 T A 8: 45,747,827 (GRCm39) probably benign Het
Krit1 A G 5: 3,862,349 (GRCm39) H168R possibly damaging Het
Map3k21 A T 8: 126,654,340 (GRCm39) E386D probably damaging Het
Muc16 C T 9: 18,556,385 (GRCm39) E3303K unknown Het
Muc5b T G 7: 141,415,250 (GRCm39) V2732G possibly damaging Het
Myo5a T C 9: 75,104,983 (GRCm39) L189P Het
Nlrc5 T C 8: 95,248,598 (GRCm39) L1740S probably damaging Het
Nolc1 A G 19: 46,071,257 (GRCm39) K402R probably benign Het
Or4b1b T A 2: 90,112,098 (GRCm39) T274S possibly damaging Het
Or52s19 T C 7: 103,008,219 (GRCm39) M61V probably damaging Het
Or8u8 T C 2: 86,012,417 (GRCm39) I13V probably benign Het
Pnma8b A G 7: 16,678,874 (GRCm39) probably benign Het
Pnpt1 A T 11: 29,080,860 (GRCm39) M35L probably benign Het
Postn A G 3: 54,270,091 (GRCm39) K57E probably damaging Het
Ppp1r9a A C 6: 4,905,775 (GRCm39) D110A probably damaging Het
Pptc7 G A 5: 122,422,942 (GRCm39) V71M possibly damaging Het
Prdm11 T A 2: 92,843,052 (GRCm39) I136F possibly damaging Het
Rfc1 A G 5: 65,436,841 (GRCm39) L613P probably damaging Het
Ryr3 T C 2: 112,560,818 (GRCm39) D2981G probably benign Het
Sbf2 C A 7: 110,213,923 (GRCm39) E16* probably null Het
Scara3 T C 14: 66,168,651 (GRCm39) E322G probably damaging Het
Sema5b T A 16: 35,481,700 (GRCm39) C893S probably damaging Het
Setdb1 T C 3: 95,249,139 (GRCm39) D323G probably damaging Het
Slc19a3 T C 1: 82,991,649 (GRCm39) Y453C probably damaging Het
Snx5 T C 2: 144,099,894 (GRCm39) K137E probably damaging Het
Taar8c G A 10: 23,977,116 (GRCm39) T232I probably benign Het
Taok2 G A 7: 126,474,050 (GRCm39) T352I probably damaging Het
Ttc3 C A 16: 94,219,541 (GRCm39) R489S possibly damaging Het
Usp12 A T 5: 146,689,264 (GRCm39) probably null Het
Usp16 T A 16: 87,263,174 (GRCm39) C125* probably null Het
Vmn2r106 C T 17: 20,488,201 (GRCm39) E733K probably damaging Het
Vps13b T A 15: 35,876,843 (GRCm39) I2832K probably benign Het
Vps13c A G 9: 67,747,761 (GRCm39) Y18C probably damaging Het
Zfp160 T A 17: 21,246,455 (GRCm39) I335K probably benign Het
Zfp788 A T 7: 41,298,275 (GRCm39) I304F possibly damaging Het
Other mutations in Or4k15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Or4k15 APN 14 50,364,214 (GRCm39) missense probably damaging 1.00
IGL01306:Or4k15 APN 14 50,364,039 (GRCm39) missense probably benign 0.00
ANU23:Or4k15 UTSW 14 50,364,039 (GRCm39) missense probably benign 0.00
R0498:Or4k15 UTSW 14 50,364,750 (GRCm39) missense probably damaging 1.00
R0574:Or4k15 UTSW 14 50,364,139 (GRCm39) missense probably damaging 1.00
R1201:Or4k15 UTSW 14 50,364,813 (GRCm39) missense probably damaging 1.00
R2112:Or4k15 UTSW 14 50,364,080 (GRCm39) missense probably damaging 1.00
R2435:Or4k15 UTSW 14 50,364,211 (GRCm39) missense probably damaging 1.00
R4238:Or4k15 UTSW 14 50,364,889 (GRCm39) missense probably benign
R4611:Or4k15 UTSW 14 50,364,530 (GRCm39) missense probably benign 0.12
R4663:Or4k15 UTSW 14 50,364,939 (GRCm39) missense probably benign 0.00
R4672:Or4k15 UTSW 14 50,364,714 (GRCm39) missense probably benign 0.02
R5022:Or4k15 UTSW 14 50,364,469 (GRCm39) missense possibly damaging 0.78
R5062:Or4k15 UTSW 14 50,364,894 (GRCm39) missense probably damaging 1.00
R5924:Or4k15 UTSW 14 50,364,139 (GRCm39) missense probably damaging 1.00
R6702:Or4k15 UTSW 14 50,364,688 (GRCm39) missense probably damaging 1.00
R6703:Or4k15 UTSW 14 50,364,688 (GRCm39) missense probably damaging 1.00
R7615:Or4k15 UTSW 14 50,364,446 (GRCm39) missense probably benign 0.07
R7798:Or4k15 UTSW 14 50,364,895 (GRCm39) missense probably damaging 1.00
R8413:Or4k15 UTSW 14 50,364,827 (GRCm39) missense probably benign 0.19
R8439:Or4k15 UTSW 14 50,364,604 (GRCm39) missense probably benign
R8841:Or4k15 UTSW 14 50,364,666 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGTTCCTCTGCTAGCATGG -3'
(R):5'- GTAGTAAGCCTTTAAACAGCCCCAC -3'

Sequencing Primer
(F):5'- TCTGCTAGCATGGCCAAG -3'
(R):5'- ACAGCCCCACATATTAAATAACTAAC -3'
Posted On 2019-10-17