Incidental Mutation 'R7498:Inhbb'
ID581179
Institutional Source Beutler Lab
Gene Symbol Inhbb
Ensembl Gene ENSMUSG00000037035
Gene Nameinhibin beta-B
Synonymsactivin
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.638) question?
Stock #R7498 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location119415465-119422248 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 119417878 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 227 (R227H)
Ref Sequence ENSEMBL: ENSMUSP00000044918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038765]
Predicted Effect probably damaging
Transcript: ENSMUST00000038765
AA Change: R227H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044918
Gene: ENSMUSG00000037035
AA Change: R227H

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:TGFb_propeptide 66 282 1.4e-13 PFAM
TGFB 307 411 5.55e-53 SMART
Meta Mutation Damage Score 0.1329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: This gene encodes a member of the TGF-beta (transforming growth factor-beta) superfamily of proteins. The encoded preproprotein is proteolytically processed to generate a subunit of the dimeric activin and inhibin protein complexes. These complexes activate and inhibit, respectively, follicle stimulating hormone secretion from the pituitary gland. Homozygous knockout mice for this gene exhibit eyelid defects. [provided by RefSeq, Aug 2016]
PHENOTYPE: Some homozygotes for targeted null mutations exhibit open eyes at birth and impaired maternal nuturing. Mutant females for one line exhibit extended gestation length, retarded mammary duct elongation and alveolar morphogenesis, and are unable to nurse their pups. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik G A 2: 68,667,668 E148K unknown Het
4932415D10Rik T A 10: 82,291,279 T1966S probably benign Het
Adgrl2 T A 3: 148,859,216 K243* probably null Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Ahnak A T 19: 9,012,019 I3556F probably benign Het
Akap6 C T 12: 53,142,705 R2301* probably null Het
Alg6 A G 4: 99,748,696 T305A probably damaging Het
Alpk1 C T 3: 127,679,778 A859T probably benign Het
Apba3 T A 10: 81,268,901 F3I possibly damaging Het
Birc6 A G 17: 74,660,470 E4151G probably damaging Het
Bmp2k T A 5: 97,088,119 F1134I probably benign Het
C6 A T 15: 4,763,364 H317L probably damaging Het
Catsperg2 G A 7: 29,717,102 S295L possibly damaging Het
Ccdc142 G T 6: 83,103,231 R385L possibly damaging Het
Ccdc151 A G 9: 22,002,257 I73T probably damaging Het
Ciz1 A T 2: 32,371,749 M482L probably benign Het
Crisp3 A G 17: 40,225,802 probably null Het
Dcaf15 G A 8: 84,101,763 P233S probably damaging Het
Def8 A G 8: 123,447,844 N16S probably damaging Het
Dnah7b T G 1: 46,325,765 S3569A probably damaging Het
Dok6 C T 18: 89,769,319 probably benign Het
Dopey1 A T 9: 86,494,411 T233S possibly damaging Het
Ep300 T A 15: 81,639,843 V1325D unknown Het
Fancm T A 12: 65,099,391 H629Q probably benign Het
Fbxo10 T C 4: 45,062,194 S111G probably benign Het
Fbxo21 T C 5: 118,002,174 probably null Het
Fdx1 A C 9: 51,948,598 L144R probably damaging Het
Fgfr3 GGACCTCTCCGTG GG 5: 33,735,422 probably null Het
Flot2 G A 11: 78,053,362 probably null Het
Fndc10 C T 4: 155,694,738 R80C probably damaging Het
Fut8 A T 12: 77,412,934 T274S probably benign Het
Gli2 T C 1: 118,835,835 M1529V possibly damaging Het
Gm7361 C A 5: 26,261,190 H183Q probably benign Het
Gm7697 A C 8: 69,519,823 Y91* probably null Het
Hdlbp T A 1: 93,413,615 H1007L probably benign Het
Hmcn2 A C 2: 31,383,475 probably null Het
Kifc1 A G 17: 33,883,872 F256L probably benign Het
Lman2 A T 13: 55,346,977 F326Y probably damaging Het
Mcmdc2 T C 1: 9,919,077 V242A probably benign Het
Mettl8 A C 2: 70,965,625 V306G probably damaging Het
Mog A T 17: 37,012,092 probably null Het
Morc2b G A 17: 33,137,859 A313V possibly damaging Het
Myh3 A G 11: 67,097,048 N1449S possibly damaging Het
Myh8 C A 11: 67,283,437 T200K possibly damaging Het
Myo16 T A 8: 10,400,589 H530Q unknown Het
Neb C T 2: 52,258,176 R2686H probably damaging Het
Nudt2 T C 4: 41,480,539 F141L possibly damaging Het
Obscn G A 11: 59,082,713 H1931Y probably damaging Het
Olfr121 A G 17: 37,752,351 T166A probably damaging Het
Olfr508 T A 7: 108,630,416 C141* probably null Het
Olfr710 A T 7: 106,944,368 V211D possibly damaging Het
Plcb1 T A 2: 135,262,233 L274* probably null Het
Plcb1 G T 2: 135,262,234 L274F probably damaging Het
Prc1 C T 7: 80,313,150 T564M possibly damaging Het
Psd4 G A 2: 24,406,984 R923Q probably damaging Het
Ptprj G A 2: 90,436,565 Q1300* probably null Het
Rapgef6 G T 11: 54,620,004 R249L probably damaging Het
Slain1 G A 14: 103,655,993 probably null Het
Slfn9 A T 11: 82,982,187 I630N probably damaging Het
Smg6 G A 11: 74,929,106 A68T probably benign Het
Spef2 T A 15: 9,727,539 M153L probably benign Het
St8sia4 T A 1: 95,591,693 M357L probably benign Het
Tal1 A T 4: 115,068,682 H316L possibly damaging Het
Tenm4 A G 7: 96,848,017 E1207G probably damaging Het
Tmem64 C A 4: 15,266,176 H75Q probably benign Het
Tor4a A G 2: 25,195,792 V33A probably benign Het
Traj52 C T 14: 54,165,361 T15I Het
Trim50 G A 5: 135,363,914 V228M probably benign Het
Trpm1 A T 7: 64,208,909 I360F possibly damaging Het
Trpm6 A T 19: 18,876,120 R1835W probably damaging Het
Ubn1 T C 16: 5,077,105 S672P probably damaging Het
Ugt2a2 C T 5: 87,474,641 C156Y probably damaging Het
Wnk1 T C 6: 119,927,196 S2223G unknown Het
Wnt7b G T 15: 85,543,679 A194E probably damaging Het
Zmpste24 A G 4: 121,082,831 V206A probably benign Het
Other mutations in Inhbb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02212:Inhbb APN 1 119417983 missense probably benign 0.33
R0091:Inhbb UTSW 1 119417395 missense probably damaging 1.00
R0609:Inhbb UTSW 1 119417416 missense probably damaging 1.00
R1352:Inhbb UTSW 1 119420695 missense probably benign 0.30
R2119:Inhbb UTSW 1 119420701 missense probably benign 0.04
R3964:Inhbb UTSW 1 119417561 missense probably damaging 1.00
R3966:Inhbb UTSW 1 119417561 missense probably damaging 1.00
R4996:Inhbb UTSW 1 119420818 missense probably damaging 1.00
R5709:Inhbb UTSW 1 119417530 missense probably damaging 0.97
R5973:Inhbb UTSW 1 119418076 missense possibly damaging 0.70
R6376:Inhbb UTSW 1 119417681 missense probably damaging 1.00
R6499:Inhbb UTSW 1 119417339 missense probably damaging 1.00
R6685:Inhbb UTSW 1 119417605 missense probably damaging 1.00
R7158:Inhbb UTSW 1 119421022 nonsense probably null
R8920:Inhbb UTSW 1 119417377 missense probably damaging 1.00
Z1176:Inhbb UTSW 1 119417798 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTCGATGAAGAACTGTTGCCTG -3'
(R):5'- GCAACCAGAACCTATTCGTGG -3'

Sequencing Primer
(F):5'- GATGCGATGTCTGCTATCGCC -3'
(R):5'- ACCAGAACCTATTCGTGGTGCAG -3'
Posted On2019-10-17