Incidental Mutation 'R7498:Tmem64'
ID 581193
Institutional Source Beutler Lab
Gene Symbol Tmem64
Ensembl Gene ENSMUSG00000043252
Gene Name transmembrane protein 64
Synonyms 9630015D15Rik
MMRRC Submission 045571-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.098) question?
Stock # R7498 (G1)
Quality Score 104.009
Status Not validated
Chromosome 4
Chromosomal Location 15265831-15286753 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 15266176 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 75 (H75Q)
Ref Sequence ENSEMBL: ENSMUSP00000055892 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062684]
AlphaFold Q3U145
Predicted Effect probably benign
Transcript: ENSMUST00000062684
AA Change: H75Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000055892
Gene: ENSMUSG00000043252
AA Change: H75Q

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
transmembrane domain 87 104 N/A INTRINSIC
transmembrane domain 124 146 N/A INTRINSIC
Pfam:SNARE_assoc 173 296 2.2e-21 PFAM
transmembrane domain 309 331 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 99% (75/76)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit impaired osteoclast differentiation, enhanced osteoblast differentiation and increased bone mass. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik G A 2: 68,498,012 (GRCm39) E148K unknown Het
Adgrl2 T A 3: 148,564,852 (GRCm39) K243* probably null Het
Adgrv1 A T 13: 81,588,344 (GRCm39) V4414E possibly damaging Het
Ahnak A T 19: 8,989,383 (GRCm39) I3556F probably benign Het
Akap6 C T 12: 53,189,488 (GRCm39) R2301* probably null Het
Alg6 A G 4: 99,636,933 (GRCm39) T305A probably damaging Het
Alpk1 C T 3: 127,473,427 (GRCm39) A859T probably benign Het
Apba3 T A 10: 81,104,735 (GRCm39) F3I possibly damaging Het
Birc6 A G 17: 74,967,465 (GRCm39) E4151G probably damaging Het
Bmp2k T A 5: 97,235,978 (GRCm39) F1134I probably benign Het
C6 A T 15: 4,792,846 (GRCm39) H317L probably damaging Het
Catsperg2 G A 7: 29,416,527 (GRCm39) S295L possibly damaging Het
Ccdc142 G T 6: 83,080,212 (GRCm39) R385L possibly damaging Het
Ciz1 A T 2: 32,261,761 (GRCm39) M482L probably benign Het
Crisp3 A G 17: 40,536,693 (GRCm39) probably null Het
Dcaf15 G A 8: 84,828,392 (GRCm39) P233S probably damaging Het
Def8 A G 8: 124,174,583 (GRCm39) N16S probably damaging Het
Dnah7b T G 1: 46,364,925 (GRCm39) S3569A probably damaging Het
Dok6 C T 18: 89,787,443 (GRCm39) probably benign Het
Dop1a A T 9: 86,376,464 (GRCm39) T233S possibly damaging Het
Ep300 T A 15: 81,524,044 (GRCm39) V1325D unknown Het
Fancm T A 12: 65,146,165 (GRCm39) H629Q probably benign Het
Fbxo10 T C 4: 45,062,194 (GRCm39) S111G probably benign Het
Fbxo21 T C 5: 118,140,239 (GRCm39) probably null Het
Fdx1 A C 9: 51,859,898 (GRCm39) L144R probably damaging Het
Fgfr3 GGACCTCTCCGTG GG 5: 33,892,766 (GRCm39) probably null Het
Flot2 G A 11: 77,944,188 (GRCm39) probably null Het
Fndc10 C T 4: 155,779,195 (GRCm39) R80C probably damaging Het
Fut8 A T 12: 77,459,708 (GRCm39) T274S probably benign Het
Gli2 T C 1: 118,763,565 (GRCm39) M1529V possibly damaging Het
Gm7361 C A 5: 26,466,188 (GRCm39) H183Q probably benign Het
Hdlbp T A 1: 93,341,337 (GRCm39) H1007L probably benign Het
Hmcn2 A C 2: 31,273,487 (GRCm39) probably null Het
Inhbb C T 1: 119,345,608 (GRCm39) R227H probably damaging Het
Kifc1 A G 17: 34,102,846 (GRCm39) F256L probably benign Het
Lman2 A T 13: 55,494,790 (GRCm39) F326Y probably damaging Het
Mcmdc2 T C 1: 9,989,302 (GRCm39) V242A probably benign Het
Mettl8 A C 2: 70,795,969 (GRCm39) V306G probably damaging Het
Mog A T 17: 37,322,984 (GRCm39) probably null Het
Morc2b G A 17: 33,356,833 (GRCm39) A313V possibly damaging Het
Myh3 A G 11: 66,987,874 (GRCm39) N1449S possibly damaging Het
Myh8 C A 11: 67,174,263 (GRCm39) T200K possibly damaging Het
Myo16 T A 8: 10,450,589 (GRCm39) H530Q unknown Het
Neb C T 2: 52,148,188 (GRCm39) R2686H probably damaging Het
Nudt2 T C 4: 41,480,539 (GRCm39) F141L possibly damaging Het
Obscn G A 11: 58,973,539 (GRCm39) H1931Y probably damaging Het
Odad3 A G 9: 21,913,553 (GRCm39) I73T probably damaging Het
Or10al5 A G 17: 38,063,242 (GRCm39) T166A probably damaging Het
Or2d4 A T 7: 106,543,575 (GRCm39) V211D possibly damaging Het
Or5p80 T A 7: 108,229,623 (GRCm39) C141* probably null Het
Plcb1 T A 2: 135,104,153 (GRCm39) L274* probably null Het
Plcb1 G T 2: 135,104,154 (GRCm39) L274F probably damaging Het
Potefam3d A C 8: 69,972,475 (GRCm39) Y91* probably null Het
Prc1 C T 7: 79,962,898 (GRCm39) T564M possibly damaging Het
Psd4 G A 2: 24,296,996 (GRCm39) R923Q probably damaging Het
Ptprj G A 2: 90,266,909 (GRCm39) Q1300* probably null Het
Rapgef6 G T 11: 54,510,830 (GRCm39) R249L probably damaging Het
Slain1 G A 14: 103,893,429 (GRCm39) probably null Het
Slfn9 A T 11: 82,873,013 (GRCm39) I630N probably damaging Het
Smg6 G A 11: 74,819,932 (GRCm39) A68T probably benign Het
Spata31h1 T A 10: 82,127,113 (GRCm39) T1966S probably benign Het
Spef2 T A 15: 9,727,625 (GRCm39) M153L probably benign Het
St8sia4 T A 1: 95,519,418 (GRCm39) M357L probably benign Het
Tal1 A T 4: 114,925,879 (GRCm39) H316L possibly damaging Het
Tenm4 A G 7: 96,497,224 (GRCm39) E1207G probably damaging Het
Tor4a A G 2: 25,085,804 (GRCm39) V33A probably benign Het
Traj52 C T 14: 54,402,818 (GRCm39) T15I Het
Trim50 G A 5: 135,392,768 (GRCm39) V228M probably benign Het
Trpm1 A T 7: 63,858,657 (GRCm39) I360F possibly damaging Het
Trpm6 A T 19: 18,853,484 (GRCm39) R1835W probably damaging Het
Ubn1 T C 16: 4,894,969 (GRCm39) S672P probably damaging Het
Ugt2a2 C T 5: 87,622,500 (GRCm39) C156Y probably damaging Het
Wnk1 T C 6: 119,904,157 (GRCm39) S2223G unknown Het
Wnt7b G T 15: 85,427,880 (GRCm39) A194E probably damaging Het
Zmpste24 A G 4: 120,940,028 (GRCm39) V206A probably benign Het
Other mutations in Tmem64
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Tmem64 APN 4 15,266,694 (GRCm39) missense probably damaging 1.00
IGL02407:Tmem64 APN 4 15,266,584 (GRCm39) missense probably damaging 1.00
PIT4151001:Tmem64 UTSW 4 15,283,159 (GRCm39) missense probably damaging 1.00
R0257:Tmem64 UTSW 4 15,266,343 (GRCm39) missense probably damaging 1.00
R0737:Tmem64 UTSW 4 15,266,717 (GRCm39) missense probably damaging 0.98
R2217:Tmem64 UTSW 4 15,266,658 (GRCm39) missense possibly damaging 0.89
R2218:Tmem64 UTSW 4 15,266,658 (GRCm39) missense possibly damaging 0.89
R2571:Tmem64 UTSW 4 15,266,718 (GRCm39) missense probably damaging 1.00
R5133:Tmem64 UTSW 4 15,281,119 (GRCm39) missense probably damaging 1.00
R5707:Tmem64 UTSW 4 15,266,288 (GRCm39) missense probably damaging 0.98
R7219:Tmem64 UTSW 4 15,266,700 (GRCm39) missense probably damaging 1.00
R8967:Tmem64 UTSW 4 15,266,575 (GRCm39) missense probably damaging 0.99
R9086:Tmem64 UTSW 4 15,266,718 (GRCm39) missense probably damaging 1.00
R9093:Tmem64 UTSW 4 15,266,391 (GRCm39) missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- TGACCGACCACCCAGCTATG -3'
(R):5'- CGATGAAGCCCACGACGAAG -3'

Sequencing Primer
(F):5'- GACCACCCAGCTATGTCTCCG -3'
(R):5'- TCTCCACCCAGAGCAGGAG -3'
Posted On 2019-10-17