Incidental Mutation 'R7498:Zmpste24'
ID 581198
Institutional Source Beutler Lab
Gene Symbol Zmpste24
Ensembl Gene ENSMUSG00000043207
Gene Name zinc metallopeptidase, STE24
Synonyms A530043O15Rik
MMRRC Submission 045571-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.374) question?
Stock # R7498 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 120916434-120955438 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 120940028 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 206 (V206A)
Ref Sequence ENSEMBL: ENSMUSP00000053900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058754] [ENSMUST00000135788]
AlphaFold Q80W54
Predicted Effect probably benign
Transcript: ENSMUST00000058754
AA Change: V206A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000053900
Gene: ENSMUSG00000043207
AA Change: V206A

DomainStartEndE-ValueType
Pfam:Peptidase_M48_N 41 225 2.5e-70 PFAM
Pfam:Peptidase_M48 228 473 5.5e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135788
SMART Domains Protein: ENSMUSP00000122588
Gene: ENSMUSG00000043207

DomainStartEndE-ValueType
PDB:2YPT|E 1 146 5e-58 PDB
Meta Mutation Damage Score 0.0759 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase M48A family. The encoded protein is a zinc metalloproteinase involved in the two step post-translational proteolytic cleavage of carboxy terminal residues of farnesylated prelamin A to form mature lamin A. Mutations in this gene have been associated with mandibuloacral dysplasia and restrictive dermopathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants are deficient in proteolytic processing of prelamin A and display many abnormalities including retarded growth, bone fragility, hair loss, cardiomyopathy, muscular dystrophy and lipodystrophy. Most die prematurely, but some survive and reproduce. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik G A 2: 68,498,012 (GRCm39) E148K unknown Het
Adgrl2 T A 3: 148,564,852 (GRCm39) K243* probably null Het
Adgrv1 A T 13: 81,588,344 (GRCm39) V4414E possibly damaging Het
Ahnak A T 19: 8,989,383 (GRCm39) I3556F probably benign Het
Akap6 C T 12: 53,189,488 (GRCm39) R2301* probably null Het
Alg6 A G 4: 99,636,933 (GRCm39) T305A probably damaging Het
Alpk1 C T 3: 127,473,427 (GRCm39) A859T probably benign Het
Apba3 T A 10: 81,104,735 (GRCm39) F3I possibly damaging Het
Birc6 A G 17: 74,967,465 (GRCm39) E4151G probably damaging Het
Bmp2k T A 5: 97,235,978 (GRCm39) F1134I probably benign Het
C6 A T 15: 4,792,846 (GRCm39) H317L probably damaging Het
Catsperg2 G A 7: 29,416,527 (GRCm39) S295L possibly damaging Het
Ccdc142 G T 6: 83,080,212 (GRCm39) R385L possibly damaging Het
Ciz1 A T 2: 32,261,761 (GRCm39) M482L probably benign Het
Crisp3 A G 17: 40,536,693 (GRCm39) probably null Het
Dcaf15 G A 8: 84,828,392 (GRCm39) P233S probably damaging Het
Def8 A G 8: 124,174,583 (GRCm39) N16S probably damaging Het
Dnah7b T G 1: 46,364,925 (GRCm39) S3569A probably damaging Het
Dok6 C T 18: 89,787,443 (GRCm39) probably benign Het
Dop1a A T 9: 86,376,464 (GRCm39) T233S possibly damaging Het
Ep300 T A 15: 81,524,044 (GRCm39) V1325D unknown Het
Fancm T A 12: 65,146,165 (GRCm39) H629Q probably benign Het
Fbxo10 T C 4: 45,062,194 (GRCm39) S111G probably benign Het
Fbxo21 T C 5: 118,140,239 (GRCm39) probably null Het
Fdx1 A C 9: 51,859,898 (GRCm39) L144R probably damaging Het
Fgfr3 GGACCTCTCCGTG GG 5: 33,892,766 (GRCm39) probably null Het
Flot2 G A 11: 77,944,188 (GRCm39) probably null Het
Fndc10 C T 4: 155,779,195 (GRCm39) R80C probably damaging Het
Fut8 A T 12: 77,459,708 (GRCm39) T274S probably benign Het
Gli2 T C 1: 118,763,565 (GRCm39) M1529V possibly damaging Het
Gm7361 C A 5: 26,466,188 (GRCm39) H183Q probably benign Het
Hdlbp T A 1: 93,341,337 (GRCm39) H1007L probably benign Het
Hmcn2 A C 2: 31,273,487 (GRCm39) probably null Het
Inhbb C T 1: 119,345,608 (GRCm39) R227H probably damaging Het
Kifc1 A G 17: 34,102,846 (GRCm39) F256L probably benign Het
Lman2 A T 13: 55,494,790 (GRCm39) F326Y probably damaging Het
Mcmdc2 T C 1: 9,989,302 (GRCm39) V242A probably benign Het
Mettl8 A C 2: 70,795,969 (GRCm39) V306G probably damaging Het
Mog A T 17: 37,322,984 (GRCm39) probably null Het
Morc2b G A 17: 33,356,833 (GRCm39) A313V possibly damaging Het
Myh3 A G 11: 66,987,874 (GRCm39) N1449S possibly damaging Het
Myh8 C A 11: 67,174,263 (GRCm39) T200K possibly damaging Het
Myo16 T A 8: 10,450,589 (GRCm39) H530Q unknown Het
Neb C T 2: 52,148,188 (GRCm39) R2686H probably damaging Het
Nudt2 T C 4: 41,480,539 (GRCm39) F141L possibly damaging Het
Obscn G A 11: 58,973,539 (GRCm39) H1931Y probably damaging Het
Odad3 A G 9: 21,913,553 (GRCm39) I73T probably damaging Het
Or10al5 A G 17: 38,063,242 (GRCm39) T166A probably damaging Het
Or2d4 A T 7: 106,543,575 (GRCm39) V211D possibly damaging Het
Or5p80 T A 7: 108,229,623 (GRCm39) C141* probably null Het
Plcb1 T A 2: 135,104,153 (GRCm39) L274* probably null Het
Plcb1 G T 2: 135,104,154 (GRCm39) L274F probably damaging Het
Potefam3d A C 8: 69,972,475 (GRCm39) Y91* probably null Het
Prc1 C T 7: 79,962,898 (GRCm39) T564M possibly damaging Het
Psd4 G A 2: 24,296,996 (GRCm39) R923Q probably damaging Het
Ptprj G A 2: 90,266,909 (GRCm39) Q1300* probably null Het
Rapgef6 G T 11: 54,510,830 (GRCm39) R249L probably damaging Het
Slain1 G A 14: 103,893,429 (GRCm39) probably null Het
Slfn9 A T 11: 82,873,013 (GRCm39) I630N probably damaging Het
Smg6 G A 11: 74,819,932 (GRCm39) A68T probably benign Het
Spata31h1 T A 10: 82,127,113 (GRCm39) T1966S probably benign Het
Spef2 T A 15: 9,727,625 (GRCm39) M153L probably benign Het
St8sia4 T A 1: 95,519,418 (GRCm39) M357L probably benign Het
Tal1 A T 4: 114,925,879 (GRCm39) H316L possibly damaging Het
Tenm4 A G 7: 96,497,224 (GRCm39) E1207G probably damaging Het
Tmem64 C A 4: 15,266,176 (GRCm39) H75Q probably benign Het
Tor4a A G 2: 25,085,804 (GRCm39) V33A probably benign Het
Traj52 C T 14: 54,402,818 (GRCm39) T15I Het
Trim50 G A 5: 135,392,768 (GRCm39) V228M probably benign Het
Trpm1 A T 7: 63,858,657 (GRCm39) I360F possibly damaging Het
Trpm6 A T 19: 18,853,484 (GRCm39) R1835W probably damaging Het
Ubn1 T C 16: 4,894,969 (GRCm39) S672P probably damaging Het
Ugt2a2 C T 5: 87,622,500 (GRCm39) C156Y probably damaging Het
Wnk1 T C 6: 119,904,157 (GRCm39) S2223G unknown Het
Wnt7b G T 15: 85,427,880 (GRCm39) A194E probably damaging Het
Other mutations in Zmpste24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Zmpste24 APN 4 120,940,012 (GRCm39) unclassified probably benign
IGL00672:Zmpste24 APN 4 120,923,057 (GRCm39) missense probably damaging 1.00
IGL00828:Zmpste24 APN 4 120,931,717 (GRCm39) missense possibly damaging 0.66
IGL01731:Zmpste24 APN 4 120,955,081 (GRCm39) missense probably benign
IGL01738:Zmpste24 APN 4 120,918,308 (GRCm39) missense probably damaging 1.00
IGL02668:Zmpste24 APN 4 120,918,297 (GRCm39) missense probably damaging 1.00
R0097:Zmpste24 UTSW 4 120,952,740 (GRCm39) splice site probably benign
R0097:Zmpste24 UTSW 4 120,952,740 (GRCm39) splice site probably benign
R0226:Zmpste24 UTSW 4 120,938,406 (GRCm39) missense probably benign 0.00
R0277:Zmpste24 UTSW 4 120,940,050 (GRCm39) missense probably damaging 1.00
R0323:Zmpste24 UTSW 4 120,940,050 (GRCm39) missense probably damaging 1.00
R1822:Zmpste24 UTSW 4 120,944,513 (GRCm39) missense possibly damaging 0.78
R2233:Zmpste24 UTSW 4 120,955,162 (GRCm39) missense probably benign 0.05
R2374:Zmpste24 UTSW 4 120,931,734 (GRCm39) missense probably benign
R3683:Zmpste24 UTSW 4 120,918,288 (GRCm39) missense probably damaging 1.00
R4810:Zmpste24 UTSW 4 120,918,251 (GRCm39) missense probably damaging 1.00
R5169:Zmpste24 UTSW 4 120,925,914 (GRCm39) missense probably damaging 1.00
R5650:Zmpste24 UTSW 4 120,940,074 (GRCm39) missense possibly damaging 0.67
R5709:Zmpste24 UTSW 4 120,923,075 (GRCm39) missense probably benign
R6429:Zmpste24 UTSW 4 120,952,867 (GRCm39) missense probably damaging 0.99
R7165:Zmpste24 UTSW 4 120,940,091 (GRCm39) missense probably null 1.00
R7353:Zmpste24 UTSW 4 120,952,778 (GRCm39) missense probably damaging 1.00
R8416:Zmpste24 UTSW 4 120,940,556 (GRCm39) missense probably benign 0.42
R8958:Zmpste24 UTSW 4 120,944,508 (GRCm39) nonsense probably null
R9138:Zmpste24 UTSW 4 120,923,018 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGGTGAAACCTAAATCCCAG -3'
(R):5'- GTCCTAGGCTGCCTACCTTATG -3'

Sequencing Primer
(F):5'- GCGGTGAAACCTAAATCCCAGTAATG -3'
(R):5'- AGGCTGCCTACCTTATGTTCTTTAAG -3'
Posted On 2019-10-17