Incidental Mutation 'R0634:Rassf5'
ID58121
Institutional Source Beutler Lab
Gene Symbol Rassf5
Ensembl Gene ENSMUSG00000026430
Gene NameRas association (RalGDS/AF-6) domain family member 5
SynonymsNore1A, Nore1B, Rapl, 1300019G20Rik
MMRRC Submission 038823-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R0634 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location131176410-131245258 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 131244956 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 59 (R59G)
Ref Sequence ENSEMBL: ENSMUSP00000108061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027688] [ENSMUST00000112442]
Predicted Effect probably benign
Transcript: ENSMUST00000027688
AA Change: R59G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000027688
Gene: ENSMUSG00000026430
AA Change: R59G

DomainStartEndE-ValueType
low complexity region 31 39 N/A INTRINSIC
low complexity region 49 67 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
C1 116 165 6.29e-8 SMART
RA 267 359 1.07e-22 SMART
Pfam:Nore1-SARAH 366 405 1.1e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112442
AA Change: R59G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108061
Gene: ENSMUSG00000026430
AA Change: R59G

DomainStartEndE-ValueType
low complexity region 31 39 N/A INTRINSIC
low complexity region 49 67 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
C1 116 165 6.29e-8 SMART
PDB:3DDC|B 198 301 7e-62 PDB
Blast:RA 267 294 5e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124796
Meta Mutation Damage Score 0.0709 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.2%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Ras association domain family. It functions as a tumor suppressor, and is inactivated in a variety of cancers. The encoded protein localizes to centrosomes and microtubules, and associates with the GTP-activated forms of Ras, Rap1, and several other Ras-like small GTPases. The protein regulates lymphocyte adhesion and suppresses cell growth in response to activated Rap1 or Ras. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele have defects in lymphocyte homing to lymphoid tissues, B cell maturation and dendritic cell function, and display lymphocyte hyperproliferation leading to lupus glomerulonephritis and lymphomas. Homozygotes for another null allele are resistant to TNF-induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,314,491 I2958V possibly damaging Het
Adam21 C A 12: 81,560,352 W212L probably benign Het
Adcy2 A C 13: 68,727,945 H479Q possibly damaging Het
Adcy4 T C 14: 55,781,597 R168G probably benign Het
Atp13a2 T C 4: 141,006,929 probably benign Het
C1ra G A 6: 124,517,505 E304K possibly damaging Het
C87977 A G 4: 144,209,340 probably null Het
Cc2d2a A C 5: 43,681,381 probably benign Het
Cenpe T C 3: 135,246,827 L1426P probably damaging Het
Cntn1 A T 15: 92,314,563 R869* probably null Het
Creb3l2 A T 6: 37,334,348 probably benign Het
Crybg2 G A 4: 134,075,304 probably benign Het
Csmd1 A T 8: 16,226,391 F800I probably damaging Het
Dock6 G A 9: 21,841,527 T330I probably damaging Het
Ets2 G A 16: 95,716,156 E311K possibly damaging Het
Fbxo22 A T 9: 55,214,960 Q141L probably benign Het
Fer C T 17: 64,035,508 T223M probably benign Het
Gm13757 A T 2: 88,446,617 M107K probably benign Het
Gm9774 C T 3: 92,428,809 W125* probably null Het
Gtf3c1 A T 7: 125,657,477 probably benign Het
Gtf3c2 G A 5: 31,159,806 R684* probably null Het
Hs6st3 T A 14: 119,869,062 L294* probably null Het
Ighg2c T G 12: 113,287,964 E181A unknown Het
Igkv6-15 A T 6: 70,406,779 probably benign Het
Lrmp A T 6: 145,174,628 H523L probably damaging Het
Map2k6 C T 11: 110,494,343 R178* probably null Het
Meikin T A 11: 54,390,483 D126E probably benign Het
Mgst1 A T 6: 138,156,331 T37S probably damaging Het
Mrc2 G A 11: 105,347,692 V1222M probably benign Het
Myom2 C A 8: 15,119,216 probably benign Het
Negr1 A G 3: 157,016,266 K159R possibly damaging Het
Nptx1 T C 11: 119,543,301 T320A possibly damaging Het
Olfr490 T C 7: 108,286,296 I277V probably benign Het
Olfr530 A T 7: 140,373,397 V71E possibly damaging Het
Pes1 C T 11: 3,977,794 probably benign Het
Pes1 T G 11: 3,977,795 probably benign Het
Pkhd1 A T 1: 20,117,474 Y3537N probably damaging Het
Poteg G A 8: 27,473,587 G289R probably benign Het
Reln A T 5: 22,018,869 W961R probably damaging Het
Rhot2 G A 17: 25,842,028 H168Y possibly damaging Het
Ripk3 G T 14: 55,788,391 probably benign Het
Samm50 A G 15: 84,214,171 silent Het
Sap30bp T C 11: 115,957,403 I117T probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Sipa1l2 A T 8: 125,422,624 L1632* probably null Het
Sirt7 T C 11: 120,622,129 probably benign Het
Smg8 T C 11: 87,086,108 T216A possibly damaging Het
Sox9 A G 11: 112,784,942 Y319C probably damaging Het
Sspn G A 6: 145,961,151 A27T possibly damaging Het
Suco A G 1: 161,838,804 V509A possibly damaging Het
Svep1 C T 4: 58,070,661 C2375Y possibly damaging Het
Trbv21 T A 6: 41,203,050 probably benign Het
Uimc1 C T 13: 55,060,266 E455K possibly damaging Het
Upk3b A G 5: 136,040,076 T100A possibly damaging Het
Usp47 A G 7: 112,108,655 N1303D probably damaging Het
Vav1 A T 17: 57,303,862 D476V probably benign Het
Vmn1r68 A G 7: 10,527,235 V312A probably benign Het
Wdr62 A G 7: 30,270,174 V287A probably damaging Het
Zcchc4 C T 5: 52,783,208 P40S probably benign Het
Zfp326 T A 5: 105,886,203 Y26* probably null Het
Zfp592 A G 7: 81,038,071 H915R probably damaging Het
Other mutations in Rassf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02728:Rassf5 APN 1 131180599 missense probably damaging 0.96
IGL03055:Rassf5 UTSW 1 131244995 missense probably benign 0.00
R0464:Rassf5 UTSW 1 131212261 missense probably benign 0.00
R0589:Rassf5 UTSW 1 131244983 missense probably damaging 0.99
R0639:Rassf5 UTSW 1 131245066 missense probably damaging 1.00
R0727:Rassf5 UTSW 1 131181265 missense probably damaging 1.00
R1926:Rassf5 UTSW 1 131212339 missense probably damaging 1.00
R2310:Rassf5 UTSW 1 131244740 missense probably damaging 1.00
R5354:Rassf5 UTSW 1 131180648 missense probably benign 0.00
R5422:Rassf5 UTSW 1 131181174 missense possibly damaging 0.87
R5490:Rassf5 UTSW 1 131181195 missense possibly damaging 0.95
R6189:Rassf5 UTSW 1 131244979 missense probably damaging 1.00
R6328:Rassf5 UTSW 1 131180668 missense probably damaging 1.00
R6531:Rassf5 UTSW 1 131244814 missense possibly damaging 0.93
R6759:Rassf5 UTSW 1 131182251 missense probably benign 0.08
R7115:Rassf5 UTSW 1 131181249 missense probably benign 0.21
R7350:Rassf5 UTSW 1 131178536 missense possibly damaging 0.75
R7910:Rassf5 UTSW 1 131180629 missense probably benign 0.15
R7991:Rassf5 UTSW 1 131180629 missense probably benign 0.15
Z1176:Rassf5 UTSW 1 131182217 missense not run
Predicted Primers PCR Primer
(F):5'- TGGTCAGTGGGCAGCCATTAAAG -3'
(R):5'- AGTCGCCGAGTCACTCCTAAATCC -3'

Sequencing Primer
(F):5'- GCTGTCTCCAAAGGTAACCTG -3'
(R):5'- TCCTAAATCCACGCGGCTC -3'
Posted On2013-07-11