Incidental Mutation 'R7498:Or2d4'
ID 581212
Institutional Source Beutler Lab
Gene Symbol Or2d4
Ensembl Gene ENSMUSG00000045581
Gene Name olfactory receptor family 2 subfamily D member 4
Synonyms MOR260-3, Olfr710, GA_x6K02T2PBJ9-9325348-9324416
MMRRC Submission 045571-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.067) question?
Stock # R7498 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 106543274-106547519 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 106543575 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 211 (V211D)
Ref Sequence ENSEMBL: ENSMUSP00000062956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055923]
AlphaFold Q9EP55
Predicted Effect possibly damaging
Transcript: ENSMUST00000055923
AA Change: V211D

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000062956
Gene: ENSMUSG00000045581
AA Change: V211D

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.1e-53 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.9e-9 PFAM
Pfam:7tm_1 41 290 1.2e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik G A 2: 68,498,012 (GRCm39) E148K unknown Het
Adgrl2 T A 3: 148,564,852 (GRCm39) K243* probably null Het
Adgrv1 A T 13: 81,588,344 (GRCm39) V4414E possibly damaging Het
Ahnak A T 19: 8,989,383 (GRCm39) I3556F probably benign Het
Akap6 C T 12: 53,189,488 (GRCm39) R2301* probably null Het
Alg6 A G 4: 99,636,933 (GRCm39) T305A probably damaging Het
Alpk1 C T 3: 127,473,427 (GRCm39) A859T probably benign Het
Apba3 T A 10: 81,104,735 (GRCm39) F3I possibly damaging Het
Birc6 A G 17: 74,967,465 (GRCm39) E4151G probably damaging Het
Bmp2k T A 5: 97,235,978 (GRCm39) F1134I probably benign Het
C6 A T 15: 4,792,846 (GRCm39) H317L probably damaging Het
Catsperg2 G A 7: 29,416,527 (GRCm39) S295L possibly damaging Het
Ccdc142 G T 6: 83,080,212 (GRCm39) R385L possibly damaging Het
Ciz1 A T 2: 32,261,761 (GRCm39) M482L probably benign Het
Crisp3 A G 17: 40,536,693 (GRCm39) probably null Het
Dcaf15 G A 8: 84,828,392 (GRCm39) P233S probably damaging Het
Def8 A G 8: 124,174,583 (GRCm39) N16S probably damaging Het
Dnah7b T G 1: 46,364,925 (GRCm39) S3569A probably damaging Het
Dok6 C T 18: 89,787,443 (GRCm39) probably benign Het
Dop1a A T 9: 86,376,464 (GRCm39) T233S possibly damaging Het
Ep300 T A 15: 81,524,044 (GRCm39) V1325D unknown Het
Fancm T A 12: 65,146,165 (GRCm39) H629Q probably benign Het
Fbxo10 T C 4: 45,062,194 (GRCm39) S111G probably benign Het
Fbxo21 T C 5: 118,140,239 (GRCm39) probably null Het
Fdx1 A C 9: 51,859,898 (GRCm39) L144R probably damaging Het
Fgfr3 GGACCTCTCCGTG GG 5: 33,892,766 (GRCm39) probably null Het
Flot2 G A 11: 77,944,188 (GRCm39) probably null Het
Fndc10 C T 4: 155,779,195 (GRCm39) R80C probably damaging Het
Fut8 A T 12: 77,459,708 (GRCm39) T274S probably benign Het
Gli2 T C 1: 118,763,565 (GRCm39) M1529V possibly damaging Het
Gm7361 C A 5: 26,466,188 (GRCm39) H183Q probably benign Het
Hdlbp T A 1: 93,341,337 (GRCm39) H1007L probably benign Het
Hmcn2 A C 2: 31,273,487 (GRCm39) probably null Het
Inhbb C T 1: 119,345,608 (GRCm39) R227H probably damaging Het
Kifc1 A G 17: 34,102,846 (GRCm39) F256L probably benign Het
Lman2 A T 13: 55,494,790 (GRCm39) F326Y probably damaging Het
Mcmdc2 T C 1: 9,989,302 (GRCm39) V242A probably benign Het
Mettl8 A C 2: 70,795,969 (GRCm39) V306G probably damaging Het
Mog A T 17: 37,322,984 (GRCm39) probably null Het
Morc2b G A 17: 33,356,833 (GRCm39) A313V possibly damaging Het
Myh3 A G 11: 66,987,874 (GRCm39) N1449S possibly damaging Het
Myh8 C A 11: 67,174,263 (GRCm39) T200K possibly damaging Het
Myo16 T A 8: 10,450,589 (GRCm39) H530Q unknown Het
Neb C T 2: 52,148,188 (GRCm39) R2686H probably damaging Het
Nudt2 T C 4: 41,480,539 (GRCm39) F141L possibly damaging Het
Obscn G A 11: 58,973,539 (GRCm39) H1931Y probably damaging Het
Odad3 A G 9: 21,913,553 (GRCm39) I73T probably damaging Het
Or10al5 A G 17: 38,063,242 (GRCm39) T166A probably damaging Het
Or5p80 T A 7: 108,229,623 (GRCm39) C141* probably null Het
Plcb1 T A 2: 135,104,153 (GRCm39) L274* probably null Het
Plcb1 G T 2: 135,104,154 (GRCm39) L274F probably damaging Het
Potefam3d A C 8: 69,972,475 (GRCm39) Y91* probably null Het
Prc1 C T 7: 79,962,898 (GRCm39) T564M possibly damaging Het
Psd4 G A 2: 24,296,996 (GRCm39) R923Q probably damaging Het
Ptprj G A 2: 90,266,909 (GRCm39) Q1300* probably null Het
Rapgef6 G T 11: 54,510,830 (GRCm39) R249L probably damaging Het
Slain1 G A 14: 103,893,429 (GRCm39) probably null Het
Slfn9 A T 11: 82,873,013 (GRCm39) I630N probably damaging Het
Smg6 G A 11: 74,819,932 (GRCm39) A68T probably benign Het
Spata31h1 T A 10: 82,127,113 (GRCm39) T1966S probably benign Het
Spef2 T A 15: 9,727,625 (GRCm39) M153L probably benign Het
St8sia4 T A 1: 95,519,418 (GRCm39) M357L probably benign Het
Tal1 A T 4: 114,925,879 (GRCm39) H316L possibly damaging Het
Tenm4 A G 7: 96,497,224 (GRCm39) E1207G probably damaging Het
Tmem64 C A 4: 15,266,176 (GRCm39) H75Q probably benign Het
Tor4a A G 2: 25,085,804 (GRCm39) V33A probably benign Het
Traj52 C T 14: 54,402,818 (GRCm39) T15I Het
Trim50 G A 5: 135,392,768 (GRCm39) V228M probably benign Het
Trpm1 A T 7: 63,858,657 (GRCm39) I360F possibly damaging Het
Trpm6 A T 19: 18,853,484 (GRCm39) R1835W probably damaging Het
Ubn1 T C 16: 4,894,969 (GRCm39) S672P probably damaging Het
Ugt2a2 C T 5: 87,622,500 (GRCm39) C156Y probably damaging Het
Wnk1 T C 6: 119,904,157 (GRCm39) S2223G unknown Het
Wnt7b G T 15: 85,427,880 (GRCm39) A194E probably damaging Het
Zmpste24 A G 4: 120,940,028 (GRCm39) V206A probably benign Het
Other mutations in Or2d4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Or2d4 APN 7 106,543,748 (GRCm39) missense possibly damaging 0.77
IGL01534:Or2d4 APN 7 106,543,546 (GRCm39) missense probably damaging 1.00
IGL02041:Or2d4 APN 7 106,543,320 (GRCm39) missense possibly damaging 0.78
IGL02414:Or2d4 APN 7 106,543,965 (GRCm39) missense probably benign 0.33
IGL02695:Or2d4 APN 7 106,543,870 (GRCm39) missense possibly damaging 0.93
IGL03167:Or2d4 APN 7 106,543,852 (GRCm39) missense probably damaging 0.99
IGL03242:Or2d4 APN 7 106,544,125 (GRCm39) missense possibly damaging 0.59
R1985:Or2d4 UTSW 7 106,544,133 (GRCm39) missense probably benign 0.00
R2234:Or2d4 UTSW 7 106,543,827 (GRCm39) missense probably damaging 1.00
R3414:Or2d4 UTSW 7 106,543,383 (GRCm39) nonsense probably null
R3731:Or2d4 UTSW 7 106,543,684 (GRCm39) missense probably damaging 0.99
R3777:Or2d4 UTSW 7 106,543,519 (GRCm39) missense probably benign 0.05
R4646:Or2d4 UTSW 7 106,543,547 (GRCm39) missense probably benign 0.01
R4647:Or2d4 UTSW 7 106,543,547 (GRCm39) missense probably benign 0.01
R4661:Or2d4 UTSW 7 106,544,074 (GRCm39) missense probably damaging 0.98
R4679:Or2d4 UTSW 7 106,544,152 (GRCm39) missense probably benign 0.10
R5200:Or2d4 UTSW 7 106,544,187 (GRCm39) missense possibly damaging 0.77
R5495:Or2d4 UTSW 7 106,543,699 (GRCm39) nonsense probably null
R6744:Or2d4 UTSW 7 106,543,741 (GRCm39) missense probably damaging 1.00
R6908:Or2d4 UTSW 7 106,543,839 (GRCm39) missense possibly damaging 0.82
R7463:Or2d4 UTSW 7 106,543,380 (GRCm39) missense probably damaging 0.99
R8686:Or2d4 UTSW 7 106,543,905 (GRCm39) missense probably benign 0.01
R9283:Or2d4 UTSW 7 106,543,806 (GRCm39) missense probably benign 0.01
RF003:Or2d4 UTSW 7 106,543,855 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATGGGTTCATCATGGATGTTAC -3'
(R):5'- GCTAGTTGTAGGATCCTGGAC -3'

Sequencing Primer
(F):5'- AGTAGAATACCGAGATTACCTTATCC -3'
(R):5'- AGGATCCTGGACTAGTGGAATATTTG -3'
Posted On 2019-10-17