Incidental Mutation 'R0634:Suco'
ID58122
Institutional Source Beutler Lab
Gene Symbol Suco
Ensembl Gene ENSMUSG00000040297
Gene NameSUN domain containing ossification factor
SynonymsAI848100, Opt, osteopotentia
MMRRC Submission 038823-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.797) question?
Stock #R0634 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location161816114-161876682 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 161838804 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 509 (V509A)
Ref Sequence ENSEMBL: ENSMUSP00000044815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048377]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048377
AA Change: V509A

PolyPhen 2 Score 0.772 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000044815
Gene: ENSMUSG00000040297
AA Change: V509A

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 32 41 N/A INTRINSIC
low complexity region 117 145 N/A INTRINSIC
low complexity region 208 224 N/A INTRINSIC
low complexity region 272 284 N/A INTRINSIC
Pfam:Sad1_UNC 325 455 9e-43 PFAM
low complexity region 665 683 N/A INTRINSIC
low complexity region 745 758 N/A INTRINSIC
coiled coil region 933 1009 N/A INTRINSIC
low complexity region 1014 1030 N/A INTRINSIC
low complexity region 1105 1119 N/A INTRINSIC
low complexity region 1163 1176 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194106
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194388
Meta Mutation Damage Score 0.1072 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.2%
Validation Efficiency 98% (62/63)
MGI Phenotype PHENOTYPE: Mice homozygous for a mutation in this gene display background strain-dependent neonatal and postnatal lethality, and impaired osteoblast differentiation resulting in impaired bone formation, brittle bones, and impaired fracture repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,314,491 I2958V possibly damaging Het
Adam21 C A 12: 81,560,352 W212L probably benign Het
Adcy2 A C 13: 68,727,945 H479Q possibly damaging Het
Adcy4 T C 14: 55,781,597 R168G probably benign Het
Atp13a2 T C 4: 141,006,929 probably benign Het
C1ra G A 6: 124,517,505 E304K possibly damaging Het
C87977 A G 4: 144,209,340 probably null Het
Cc2d2a A C 5: 43,681,381 probably benign Het
Cenpe T C 3: 135,246,827 L1426P probably damaging Het
Cntn1 A T 15: 92,314,563 R869* probably null Het
Creb3l2 A T 6: 37,334,348 probably benign Het
Crybg2 G A 4: 134,075,304 probably benign Het
Csmd1 A T 8: 16,226,391 F800I probably damaging Het
Dock6 G A 9: 21,841,527 T330I probably damaging Het
Ets2 G A 16: 95,716,156 E311K possibly damaging Het
Fbxo22 A T 9: 55,214,960 Q141L probably benign Het
Fer C T 17: 64,035,508 T223M probably benign Het
Gm13757 A T 2: 88,446,617 M107K probably benign Het
Gm9774 C T 3: 92,428,809 W125* probably null Het
Gtf3c1 A T 7: 125,657,477 probably benign Het
Gtf3c2 G A 5: 31,159,806 R684* probably null Het
Hs6st3 T A 14: 119,869,062 L294* probably null Het
Ighg2c T G 12: 113,287,964 E181A unknown Het
Igkv6-15 A T 6: 70,406,779 probably benign Het
Lrmp A T 6: 145,174,628 H523L probably damaging Het
Map2k6 C T 11: 110,494,343 R178* probably null Het
Meikin T A 11: 54,390,483 D126E probably benign Het
Mgst1 A T 6: 138,156,331 T37S probably damaging Het
Mrc2 G A 11: 105,347,692 V1222M probably benign Het
Myom2 C A 8: 15,119,216 probably benign Het
Negr1 A G 3: 157,016,266 K159R possibly damaging Het
Nptx1 T C 11: 119,543,301 T320A possibly damaging Het
Olfr490 T C 7: 108,286,296 I277V probably benign Het
Olfr530 A T 7: 140,373,397 V71E possibly damaging Het
Pes1 C T 11: 3,977,794 probably benign Het
Pes1 T G 11: 3,977,795 probably benign Het
Pkhd1 A T 1: 20,117,474 Y3537N probably damaging Het
Poteg G A 8: 27,473,587 G289R probably benign Het
Rassf5 T C 1: 131,244,956 R59G probably damaging Het
Reln A T 5: 22,018,869 W961R probably damaging Het
Rhot2 G A 17: 25,842,028 H168Y possibly damaging Het
Ripk3 G T 14: 55,788,391 probably benign Het
Samm50 A G 15: 84,214,171 silent Het
Sap30bp T C 11: 115,957,403 I117T probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Sipa1l2 A T 8: 125,422,624 L1632* probably null Het
Sirt7 T C 11: 120,622,129 probably benign Het
Smg8 T C 11: 87,086,108 T216A possibly damaging Het
Sox9 A G 11: 112,784,942 Y319C probably damaging Het
Sspn G A 6: 145,961,151 A27T possibly damaging Het
Svep1 C T 4: 58,070,661 C2375Y possibly damaging Het
Trbv21 T A 6: 41,203,050 probably benign Het
Uimc1 C T 13: 55,060,266 E455K possibly damaging Het
Upk3b A G 5: 136,040,076 T100A possibly damaging Het
Usp47 A G 7: 112,108,655 N1303D probably damaging Het
Vav1 A T 17: 57,303,862 D476V probably benign Het
Vmn1r68 A G 7: 10,527,235 V312A probably benign Het
Wdr62 A G 7: 30,270,174 V287A probably damaging Het
Zcchc4 C T 5: 52,783,208 P40S probably benign Het
Zfp326 T A 5: 105,886,203 Y26* probably null Het
Zfp592 A G 7: 81,038,071 H915R probably damaging Het
Other mutations in Suco
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Suco APN 1 161834120 missense probably damaging 1.00
IGL01688:Suco APN 1 161863911 splice site probably null
IGL01794:Suco APN 1 161827725 missense probably benign 0.01
IGL01891:Suco APN 1 161838802 missense probably damaging 1.00
IGL02028:Suco APN 1 161856859 missense possibly damaging 0.95
IGL02102:Suco APN 1 161827705 missense probably damaging 1.00
IGL02351:Suco APN 1 161818626 missense probably benign 0.35
IGL02358:Suco APN 1 161818626 missense probably benign 0.35
IGL02392:Suco APN 1 161834567 missense probably benign 0.11
IGL02638:Suco APN 1 161827687 missense probably damaging 1.00
IGL02650:Suco APN 1 161848753 splice site probably benign
IGL03106:Suco APN 1 161834480 missense possibly damaging 0.91
IGL03189:Suco APN 1 161857337 unclassified probably benign
IGL03328:Suco APN 1 161820421 missense probably damaging 0.99
girth UTSW 1 161828240 missense possibly damaging 0.86
pleasingly UTSW 1 161834408 missense possibly damaging 0.65
3-1:Suco UTSW 1 161822031 intron probably benign
H8562:Suco UTSW 1 161852851 missense probably damaging 1.00
H8786:Suco UTSW 1 161852851 missense probably damaging 1.00
R0023:Suco UTSW 1 161845585 splice site probably null
R0023:Suco UTSW 1 161845585 splice site probably null
R0179:Suco UTSW 1 161876305 splice site probably benign
R0299:Suco UTSW 1 161853810 missense probably benign
R0418:Suco UTSW 1 161834850 missense probably benign 0.11
R0481:Suco UTSW 1 161862313 unclassified probably benign
R0610:Suco UTSW 1 161859503 missense probably benign
R0610:Suco UTSW 1 161864032 splice site probably benign
R0645:Suco UTSW 1 161834114 missense probably damaging 1.00
R1276:Suco UTSW 1 161857456 missense probably benign 0.10
R1720:Suco UTSW 1 161834054 missense probably damaging 1.00
R1739:Suco UTSW 1 161827655 critical splice donor site probably null
R1763:Suco UTSW 1 161834949 missense possibly damaging 0.80
R1835:Suco UTSW 1 161859500 nonsense probably null
R1988:Suco UTSW 1 161818811 critical splice acceptor site probably null
R2939:Suco UTSW 1 161848651 missense probably damaging 1.00
R3773:Suco UTSW 1 161843996 splice site probably null
R3882:Suco UTSW 1 161834744 missense probably benign 0.33
R4193:Suco UTSW 1 161863959 missense probably benign 0.32
R4367:Suco UTSW 1 161847230 missense probably damaging 1.00
R4397:Suco UTSW 1 161844852 missense probably damaging 1.00
R4846:Suco UTSW 1 161834408 missense possibly damaging 0.65
R4851:Suco UTSW 1 161834192 missense probably damaging 1.00
R5224:Suco UTSW 1 161834705 missense probably benign 0.06
R5329:Suco UTSW 1 161833430 missense probably damaging 0.99
R6133:Suco UTSW 1 161835183 nonsense probably null
R6632:Suco UTSW 1 161828240 missense possibly damaging 0.86
R6643:Suco UTSW 1 161859432 missense possibly damaging 0.71
R7378:Suco UTSW 1 161862211 missense possibly damaging 0.76
R7405:Suco UTSW 1 161828214 missense possibly damaging 0.65
R7509:Suco UTSW 1 161845334 missense probably damaging 1.00
R7838:Suco UTSW 1 161829321 missense probably benign 0.07
R7867:Suco UTSW 1 161837796 missense possibly damaging 0.77
R7921:Suco UTSW 1 161829321 missense probably benign 0.07
R7950:Suco UTSW 1 161837796 missense possibly damaging 0.77
R7978:Suco UTSW 1 161845368 splice site probably null
Predicted Primers PCR Primer
(F):5'- CAATTCTACCAGGGCAGAAGAGGC -3'
(R):5'- GTCCTCCATATTCCAGTCCAGGCTA -3'

Sequencing Primer
(F):5'- CAAGATGGCTAAGTTCTTTCCAATGG -3'
(R):5'- CCCTCTGAACCTTAAAATTTCAGC -3'
Posted On2013-07-11