Incidental Mutation 'R7498:4932415D10Rik'
ID581222
Institutional Source Beutler Lab
Gene Symbol 4932415D10Rik
Ensembl Gene ENSMUSG00000044581
Gene NameRIKEN cDNA 4932415D10 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R7498 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location82282116-82316582 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 82291279 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 1966 (T1966S)
Ref Sequence ENSEMBL: ENSMUSP00000151425 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000217661
AA Change: T1966S

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik G A 2: 68,667,668 E148K unknown Het
Adgrl2 T A 3: 148,859,216 K243* probably null Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Ahnak A T 19: 9,012,019 I3556F probably benign Het
Akap6 C T 12: 53,142,705 R2301* probably null Het
Alg6 A G 4: 99,748,696 T305A probably damaging Het
Alpk1 C T 3: 127,679,778 A859T probably benign Het
Apba3 T A 10: 81,268,901 F3I possibly damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 TCACTGGTT TCACTGGTTCTGTGGACACTGGTT 3: 95,888,182 probably benign Het
Birc6 A G 17: 74,660,470 E4151G probably damaging Het
Bmp2k T A 5: 97,088,119 F1134I probably benign Het
C6 A T 15: 4,763,364 H317L probably damaging Het
Catsperg2 G A 7: 29,717,102 S295L possibly damaging Het
Ccdc142 G T 6: 83,103,231 R385L possibly damaging Het
Ccdc151 A G 9: 22,002,257 I73T probably damaging Het
Ciz1 A T 2: 32,371,749 M482L probably benign Het
Crisp3 A G 17: 40,225,802 probably null Het
Dcaf15 G A 8: 84,101,763 P233S probably damaging Het
Def8 A G 8: 123,447,844 N16S probably damaging Het
Dnah7b T G 1: 46,325,765 S3569A probably damaging Het
Dok6 C T 18: 89,769,319 probably benign Het
Dopey1 A T 9: 86,494,411 T233S possibly damaging Het
Ep300 T A 15: 81,639,843 V1325D unknown Het
Fancm T A 12: 65,099,391 H629Q probably benign Het
Fbxo10 T C 4: 45,062,194 S111G probably benign Het
Fbxo21 T C 5: 118,002,174 probably null Het
Fdx1 A C 9: 51,948,598 L144R probably damaging Het
Fgfr3 GGACCTCTCCGTG GG 5: 33,735,422 probably null Het
Flot2 G A 11: 78,053,362 probably null Het
Fndc10 C T 4: 155,694,738 R80C probably damaging Het
Fut8 A T 12: 77,412,934 T274S probably benign Het
Gli2 T C 1: 118,835,835 M1529V possibly damaging Het
Gm7361 C A 5: 26,261,190 H183Q probably benign Het
Gm7697 A C 8: 69,519,823 Y91* probably null Het
Hdlbp T A 1: 93,413,615 H1007L probably benign Het
Hmcn2 A C 2: 31,383,475 probably null Het
Inhbb C T 1: 119,417,878 R227H probably damaging Het
Kifc1 A G 17: 33,883,872 F256L probably benign Het
Lman2 A T 13: 55,346,977 F326Y probably damaging Het
Mcmdc2 T C 1: 9,919,077 V242A probably benign Het
Mettl8 A C 2: 70,965,625 V306G probably damaging Het
Mog A T 17: 37,012,092 probably null Het
Morc2b G A 17: 33,137,859 A313V possibly damaging Het
Myh3 A G 11: 67,097,048 N1449S possibly damaging Het
Myh8 C A 11: 67,283,437 T200K possibly damaging Het
Myo16 T A 8: 10,400,589 H530Q unknown Het
Neb C T 2: 52,258,176 R2686H probably damaging Het
Nudt2 T C 4: 41,480,539 F141L possibly damaging Het
Obscn G A 11: 59,082,713 H1931Y probably damaging Het
Olfr121 A G 17: 37,752,351 T166A probably damaging Het
Olfr508 T A 7: 108,630,416 C141* probably null Het
Olfr710 A T 7: 106,944,368 V211D possibly damaging Het
Plcb1 T A 2: 135,262,233 L274* probably null Het
Plcb1 G T 2: 135,262,234 L274F probably damaging Het
Prc1 C T 7: 80,313,150 T564M possibly damaging Het
Psd4 G A 2: 24,406,984 R923Q probably damaging Het
Ptprj G A 2: 90,436,565 Q1300* probably null Het
Rapgef6 G T 11: 54,620,004 R249L probably damaging Het
Slfn9 A T 11: 82,982,187 I630N probably damaging Het
Smg6 G A 11: 74,929,106 A68T probably benign Het
Spef2 T A 15: 9,727,539 M153L probably benign Het
St8sia4 T A 1: 95,591,693 M357L probably benign Het
Tal1 A T 4: 115,068,682 H316L possibly damaging Het
Tenm4 A G 7: 96,848,017 E1207G probably damaging Het
Tmem64 C A 4: 15,266,176 H75Q probably benign Het
Tor4a A G 2: 25,195,792 V33A probably benign Het
Traj52 C T 14: 54,165,361 T15I Het
Trim50 G A 5: 135,363,914 V228M probably benign Het
Trpm1 A T 7: 64,208,909 I360F possibly damaging Het
Trpm6 A T 19: 18,876,120 R1835W probably damaging Het
Ubn1 T C 16: 5,077,105 S672P probably damaging Het
Ugt2a2 C T 5: 87,474,641 C156Y probably damaging Het
Wnk1 T C 6: 119,927,196 S2223G unknown Het
Wnt7b G T 15: 85,543,679 A194E probably damaging Het
Zmpste24 A G 4: 121,082,831 V206A probably benign Het
Other mutations in 4932415D10Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:4932415D10Rik APN 10 82283752 missense probably benign 0.06
IGL01457:4932415D10Rik APN 10 82284734 missense probably damaging 1.00
IGL01540:4932415D10Rik APN 10 82284182 missense possibly damaging 0.87
IGL02693:4932415D10Rik APN 10 82285258 missense probably benign 0.06
IGL02867:4932415D10Rik APN 10 82283820 missense probably damaging 0.96
IGL02889:4932415D10Rik APN 10 82283820 missense probably damaging 0.96
IGL03080:4932415D10Rik APN 10 82283982 missense probably damaging 0.99
IGL03120:4932415D10Rik APN 10 82285035 missense possibly damaging 0.90
IGL03351:4932415D10Rik APN 10 82283567 utr 3 prime probably benign
FR4449:4932415D10Rik UTSW 10 82285469 frame shift probably null
FR4548:4932415D10Rik UTSW 10 82290996 small insertion probably benign
FR4737:4932415D10Rik UTSW 10 82285469 small deletion probably benign
PIT4480001:4932415D10Rik UTSW 10 82283752 missense probably benign 0.06
R0102:4932415D10Rik UTSW 10 82283556 missense probably damaging 1.00
R0312:4932415D10Rik UTSW 10 82284369 missense probably damaging 1.00
R1303:4932415D10Rik UTSW 10 82284556 missense possibly damaging 0.94
R2039:4932415D10Rik UTSW 10 82284676 missense probably damaging 1.00
R2356:4932415D10Rik UTSW 10 82283955 missense possibly damaging 0.94
R4740:4932415D10Rik UTSW 10 82283647 missense possibly damaging 0.50
R4857:4932415D10Rik UTSW 10 82283848 missense possibly damaging 0.61
R5017:4932415D10Rik UTSW 10 82296676 missense unknown
R5095:4932415D10Rik UTSW 10 82283667 missense probably damaging 1.00
R5209:4932415D10Rik UTSW 10 82283818 missense possibly damaging 0.84
R5388:4932415D10Rik UTSW 10 82283727 missense probably damaging 0.99
R5642:4932415D10Rik UTSW 10 82284483 missense probably damaging 1.00
R5646:4932415D10Rik UTSW 10 82283776 missense probably damaging 0.99
R6188:4932415D10Rik UTSW 10 82285257 missense probably damaging 0.96
R6215:4932415D10Rik UTSW 10 82291112 missense probably benign 0.07
R6252:4932415D10Rik UTSW 10 82283754 missense probably benign 0.30
R6275:4932415D10Rik UTSW 10 82285368 missense probably damaging 1.00
R6303:4932415D10Rik UTSW 10 82290368 missense possibly damaging 0.79
R6304:4932415D10Rik UTSW 10 82290368 missense possibly damaging 0.79
R6313:4932415D10Rik UTSW 10 82293636 missense probably benign 0.00
R6323:4932415D10Rik UTSW 10 82283082 missense probably benign 0.27
R6374:4932415D10Rik UTSW 10 82288897 unclassified probably benign
R6407:4932415D10Rik UTSW 10 82293811 missense probably benign 0.16
R6468:4932415D10Rik UTSW 10 82295316 missense probably benign 0.01
R6490:4932415D10Rik UTSW 10 82289304 missense possibly damaging 0.90
R6605:4932415D10Rik UTSW 10 82296037 missense probably benign 0.27
R6614:4932415D10Rik UTSW 10 82291648 missense probably benign 0.31
R6626:4932415D10Rik UTSW 10 82292833 missense probably benign 0.03
R6630:4932415D10Rik UTSW 10 82287072 missense possibly damaging 0.81
R6646:4932415D10Rik UTSW 10 82296830 missense unknown
R6723:4932415D10Rik UTSW 10 82289823 missense possibly damaging 0.50
R6751:4932415D10Rik UTSW 10 82283497 missense probably benign 0.06
R6850:4932415D10Rik UTSW 10 82293054 missense possibly damaging 0.68
R6944:4932415D10Rik UTSW 10 82296222 missense probably benign 0.03
R6957:4932415D10Rik UTSW 10 82293786 missense probably benign 0.03
R6988:4932415D10Rik UTSW 10 82291899 missense possibly damaging 0.79
R7069:4932415D10Rik UTSW 10 82289943 missense probably damaging 0.99
R7164:4932415D10Rik UTSW 10 82286229 missense probably damaging 1.00
R7175:4932415D10Rik UTSW 10 82286749 missense probably damaging 1.00
R7201:4932415D10Rik UTSW 10 82291627 missense probably benign 0.03
R7203:4932415D10Rik UTSW 10 82293414 missense probably benign 0.00
R7205:4932415D10Rik UTSW 10 82289327 missense probably benign 0.35
R7241:4932415D10Rik UTSW 10 82287042 missense probably benign 0.01
R7283:4932415D10Rik UTSW 10 82291297 missense possibly damaging 0.90
R7305:4932415D10Rik UTSW 10 82285119 missense probably benign 0.06
R7358:4932415D10Rik UTSW 10 82292013 missense possibly damaging 0.79
R7360:4932415D10Rik UTSW 10 82296507 missense unknown
R7362:4932415D10Rik UTSW 10 82292997 missense possibly damaging 0.79
R7385:4932415D10Rik UTSW 10 82287737 missense probably benign 0.03
R7385:4932415D10Rik UTSW 10 82287895 missense probably benign 0.05
R7472:4932415D10Rik UTSW 10 82283587 missense probably benign 0.03
R7493:4932415D10Rik UTSW 10 82288964 nonsense probably null
R7493:4932415D10Rik UTSW 10 82316430 missense unknown
R7512:4932415D10Rik UTSW 10 82292635 missense probably benign 0.31
R7560:4932415D10Rik UTSW 10 82284615 missense probably damaging 1.00
R7591:4932415D10Rik UTSW 10 82292212 missense probably benign 0.16
R7636:4932415D10Rik UTSW 10 82295139 missense probably benign 0.01
R7640:4932415D10Rik UTSW 10 82294656 missense probably damaging 0.99
R7709:4932415D10Rik UTSW 10 82290532 missense possibly damaging 0.81
R7790:4932415D10Rik UTSW 10 82287495 missense probably benign 0.06
RF017:4932415D10Rik UTSW 10 82290992 small insertion probably benign
RF055:4932415D10Rik UTSW 10 82290993 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GTCTTGGGCCTTGTCATCAAC -3'
(R):5'- TAGGGTCAAACTCAAAGTCACAG -3'

Sequencing Primer
(F):5'- ACCTCCCAATTTTATGGAGGG -3'
(R):5'- GTCACAGTCTCAAGAAGCCAG -3'
Posted On2019-10-17