Incidental Mutation 'R7498:Myh8'
ID581226
Institutional Source Beutler Lab
Gene Symbol Myh8
Ensembl Gene ENSMUSG00000055775
Gene Namemyosin, heavy polypeptide 8, skeletal muscle, perinatal
SynonymsMyhsp, 4832426G23Rik, MyHC-pn, Myhs-p
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.811) question?
Stock #R7498 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location67277124-67308634 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 67283437 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 200 (T200K)
Ref Sequence ENSEMBL: ENSMUSP00000019625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019625] [ENSMUST00000108685]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019625
AA Change: T200K

PolyPhen 2 Score 0.797 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000019625
Gene: ENSMUSG00000055775
AA Change: T200K

DomainStartEndE-ValueType
Pfam:Myosin_N 37 76 2.1e-13 PFAM
MYSc 82 782 N/A SMART
IQ 783 805 5.44e-3 SMART
Pfam:Myosin_tail_1 846 1927 2.4e-164 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108685
SMART Domains Protein: ENSMUSP00000104325
Gene: ENSMUSG00000055775

DomainStartEndE-ValueType
Pfam:Myosin_N 37 78 3.8e-17 PFAM
Pfam:Myosin_head 90 172 1.7e-31 PFAM
Meta Mutation Damage Score 0.0823 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: This gene encodes a myosin heavy chain. The encoded protein forms a hexamer with two heavy chains, two alkali light chains, and two regulatory light chain components. This complex functions in muscle contraction. This gene is located in a cluster of related genes on chromosome 11. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik G A 2: 68,667,668 E148K unknown Het
4932415D10Rik T A 10: 82,291,279 T1966S probably benign Het
Adgrl2 T A 3: 148,859,216 K243* probably null Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Ahnak A T 19: 9,012,019 I3556F probably benign Het
Akap6 C T 12: 53,142,705 R2301* probably null Het
Alg6 A G 4: 99,748,696 T305A probably damaging Het
Alpk1 C T 3: 127,679,778 A859T probably benign Het
Apba3 T A 10: 81,268,901 F3I possibly damaging Het
Birc6 A G 17: 74,660,470 E4151G probably damaging Het
Bmp2k T A 5: 97,088,119 F1134I probably benign Het
C6 A T 15: 4,763,364 H317L probably damaging Het
Catsperg2 G A 7: 29,717,102 S295L possibly damaging Het
Ccdc142 G T 6: 83,103,231 R385L possibly damaging Het
Ccdc151 A G 9: 22,002,257 I73T probably damaging Het
Ciz1 A T 2: 32,371,749 M482L probably benign Het
Crisp3 A G 17: 40,225,802 probably null Het
Dcaf15 G A 8: 84,101,763 P233S probably damaging Het
Def8 A G 8: 123,447,844 N16S probably damaging Het
Dnah7b T G 1: 46,325,765 S3569A probably damaging Het
Dok6 C T 18: 89,769,319 probably benign Het
Dopey1 A T 9: 86,494,411 T233S possibly damaging Het
Ep300 T A 15: 81,639,843 V1325D unknown Het
Fancm T A 12: 65,099,391 H629Q probably benign Het
Fbxo10 T C 4: 45,062,194 S111G probably benign Het
Fbxo21 T C 5: 118,002,174 probably null Het
Fdx1 A C 9: 51,948,598 L144R probably damaging Het
Fgfr3 GGACCTCTCCGTG GG 5: 33,735,422 probably null Het
Flot2 G A 11: 78,053,362 probably null Het
Fndc10 C T 4: 155,694,738 R80C probably damaging Het
Fut8 A T 12: 77,412,934 T274S probably benign Het
Gli2 T C 1: 118,835,835 M1529V possibly damaging Het
Gm7361 C A 5: 26,261,190 H183Q probably benign Het
Gm7697 A C 8: 69,519,823 Y91* probably null Het
Hdlbp T A 1: 93,413,615 H1007L probably benign Het
Hmcn2 A C 2: 31,383,475 probably null Het
Inhbb C T 1: 119,417,878 R227H probably damaging Het
Kifc1 A G 17: 33,883,872 F256L probably benign Het
Lman2 A T 13: 55,346,977 F326Y probably damaging Het
Mcmdc2 T C 1: 9,919,077 V242A probably benign Het
Mettl8 A C 2: 70,965,625 V306G probably damaging Het
Mog A T 17: 37,012,092 probably null Het
Morc2b G A 17: 33,137,859 A313V possibly damaging Het
Myh3 A G 11: 67,097,048 N1449S possibly damaging Het
Myo16 T A 8: 10,400,589 H530Q unknown Het
Neb C T 2: 52,258,176 R2686H probably damaging Het
Nudt2 T C 4: 41,480,539 F141L possibly damaging Het
Obscn G A 11: 59,082,713 H1931Y probably damaging Het
Olfr121 A G 17: 37,752,351 T166A probably damaging Het
Olfr508 T A 7: 108,630,416 C141* probably null Het
Olfr710 A T 7: 106,944,368 V211D possibly damaging Het
Plcb1 T A 2: 135,262,233 L274* probably null Het
Plcb1 G T 2: 135,262,234 L274F probably damaging Het
Prc1 C T 7: 80,313,150 T564M possibly damaging Het
Psd4 G A 2: 24,406,984 R923Q probably damaging Het
Ptprj G A 2: 90,436,565 Q1300* probably null Het
Rapgef6 G T 11: 54,620,004 R249L probably damaging Het
Slain1 G A 14: 103,655,993 probably null Het
Slfn9 A T 11: 82,982,187 I630N probably damaging Het
Smg6 G A 11: 74,929,106 A68T probably benign Het
Spef2 T A 15: 9,727,539 M153L probably benign Het
St8sia4 T A 1: 95,591,693 M357L probably benign Het
Tal1 A T 4: 115,068,682 H316L possibly damaging Het
Tenm4 A G 7: 96,848,017 E1207G probably damaging Het
Tmem64 C A 4: 15,266,176 H75Q probably benign Het
Tor4a A G 2: 25,195,792 V33A probably benign Het
Traj52 C T 14: 54,165,361 T15I Het
Trim50 G A 5: 135,363,914 V228M probably benign Het
Trpm1 A T 7: 64,208,909 I360F possibly damaging Het
Trpm6 A T 19: 18,876,120 R1835W probably damaging Het
Ubn1 T C 16: 5,077,105 S672P probably damaging Het
Ugt2a2 C T 5: 87,474,641 C156Y probably damaging Het
Wnk1 T C 6: 119,927,196 S2223G unknown Het
Wnt7b G T 15: 85,543,679 A194E probably damaging Het
Zmpste24 A G 4: 121,082,831 V206A probably benign Het
Other mutations in Myh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Myh8 APN 11 67283818 missense probably damaging 0.97
IGL01020:Myh8 APN 11 67283403 missense probably damaging 0.99
IGL01348:Myh8 APN 11 67297780 missense probably damaging 1.00
IGL01382:Myh8 APN 11 67301973 missense probably damaging 1.00
IGL01454:Myh8 APN 11 67283596 missense probably damaging 1.00
IGL01457:Myh8 APN 11 67292679 missense probably benign 0.00
IGL01472:Myh8 APN 11 67288379 splice site probably benign
IGL01473:Myh8 APN 11 67301825 critical splice donor site probably null
IGL01613:Myh8 APN 11 67301710 missense probably benign 0.11
IGL01763:Myh8 APN 11 67286419 missense probably benign 0.01
IGL01828:Myh8 APN 11 67303826 missense possibly damaging 0.82
IGL01862:Myh8 APN 11 67289694 nonsense probably null
IGL01905:Myh8 APN 11 67284651 missense possibly damaging 0.90
IGL02280:Myh8 APN 11 67283372 unclassified probably benign
IGL02386:Myh8 APN 11 67294440 missense probably damaging 0.99
IGL02449:Myh8 APN 11 67294614 critical splice donor site probably null
IGL02500:Myh8 APN 11 67305710 missense probably benign 0.00
IGL02745:Myh8 APN 11 67297501 missense possibly damaging 0.88
IGL02799:Myh8 APN 11 67301592 splice site probably benign
IGL03063:Myh8 APN 11 67288205 missense probably benign 0.00
IGL03223:Myh8 APN 11 67283818 missense probably damaging 0.97
IGL03336:Myh8 APN 11 67284702 missense probably damaging 1.00
IGL03338:Myh8 APN 11 67298346 missense probably damaging 1.00
IGL03351:Myh8 APN 11 67303913 missense possibly damaging 0.94
IGL03392:Myh8 APN 11 67294418 missense probably damaging 1.00
BB003:Myh8 UTSW 11 67278906 missense possibly damaging 0.94
BB009:Myh8 UTSW 11 67294604 missense probably benign 0.00
BB013:Myh8 UTSW 11 67278906 missense possibly damaging 0.94
BB019:Myh8 UTSW 11 67294604 missense probably benign 0.00
PIT4354001:Myh8 UTSW 11 67289630 missense probably benign 0.01
R0012:Myh8 UTSW 11 67300021 missense probably benign 0.02
R0016:Myh8 UTSW 11 67298525 missense probably damaging 1.00
R0016:Myh8 UTSW 11 67298525 missense probably damaging 1.00
R0115:Myh8 UTSW 11 67306264 splice site probably benign
R0131:Myh8 UTSW 11 67292188 missense probably damaging 0.96
R0131:Myh8 UTSW 11 67292188 missense probably damaging 0.96
R0132:Myh8 UTSW 11 67292188 missense probably damaging 0.96
R0238:Myh8 UTSW 11 67301692 missense probably benign 0.00
R0238:Myh8 UTSW 11 67301692 missense probably benign 0.00
R0239:Myh8 UTSW 11 67301692 missense probably benign 0.00
R0239:Myh8 UTSW 11 67301692 missense probably benign 0.00
R0393:Myh8 UTSW 11 67306017 splice site probably benign
R0453:Myh8 UTSW 11 67292905 missense probably benign 0.03
R0454:Myh8 UTSW 11 67303765 nonsense probably null
R0466:Myh8 UTSW 11 67298579 missense probably benign 0.01
R0487:Myh8 UTSW 11 67302011 missense probably benign
R0511:Myh8 UTSW 11 67284507 missense probably benign 0.01
R0557:Myh8 UTSW 11 67301798 missense possibly damaging 0.88
R0589:Myh8 UTSW 11 67298627 missense probably benign 0.00
R0658:Myh8 UTSW 11 67284532 critical splice donor site probably null
R0782:Myh8 UTSW 11 67289754 missense probably benign 0.16
R0829:Myh8 UTSW 11 67283500 unclassified probably benign
R0845:Myh8 UTSW 11 67286264 missense probably damaging 1.00
R0930:Myh8 UTSW 11 67305998 missense possibly damaging 0.93
R0972:Myh8 UTSW 11 67297759 missense probably damaging 1.00
R1132:Myh8 UTSW 11 67297131 nonsense probably null
R1417:Myh8 UTSW 11 67306185 missense probably damaging 1.00
R1478:Myh8 UTSW 11 67292725 missense probably benign 0.23
R1497:Myh8 UTSW 11 67289812 missense probably benign 0.00
R1605:Myh8 UTSW 11 67301671 missense probably damaging 0.99
R1701:Myh8 UTSW 11 67280138 missense probably damaging 1.00
R1950:Myh8 UTSW 11 67279004 missense possibly damaging 0.75
R1989:Myh8 UTSW 11 67292724 missense probably benign 0.00
R2010:Myh8 UTSW 11 67297164 nonsense probably null
R2095:Myh8 UTSW 11 67286224 missense probably benign 0.00
R2132:Myh8 UTSW 11 67292876 missense probably damaging 1.00
R2152:Myh8 UTSW 11 67294469 missense probably damaging 0.97
R2229:Myh8 UTSW 11 67308348 missense probably damaging 0.98
R2302:Myh8 UTSW 11 67286239 missense probably damaging 1.00
R2364:Myh8 UTSW 11 67294518 missense probably benign 0.03
R2429:Myh8 UTSW 11 67303897 missense probably benign 0.21
R2880:Myh8 UTSW 11 67297264 missense probably damaging 0.97
R3692:Myh8 UTSW 11 67301918 missense probably damaging 0.98
R3756:Myh8 UTSW 11 67284617 unclassified probably benign
R3924:Myh8 UTSW 11 67297137 missense probably damaging 0.99
R4172:Myh8 UTSW 11 67292421 missense probably damaging 1.00
R4255:Myh8 UTSW 11 67299734 missense probably benign
R4621:Myh8 UTSW 11 67286258 missense probably damaging 1.00
R4623:Myh8 UTSW 11 67286258 missense probably damaging 1.00
R4790:Myh8 UTSW 11 67279963 missense probably damaging 0.99
R4914:Myh8 UTSW 11 67292684 missense probably damaging 1.00
R5074:Myh8 UTSW 11 67305916 missense possibly damaging 0.79
R5119:Myh8 UTSW 11 67298358 missense probably damaging 1.00
R5159:Myh8 UTSW 11 67288353 missense probably damaging 0.99
R5229:Myh8 UTSW 11 67284484 missense probably damaging 0.96
R5320:Myh8 UTSW 11 67286263 missense probably damaging 1.00
R5455:Myh8 UTSW 11 67301418 missense possibly damaging 0.59
R5523:Myh8 UTSW 11 67305962 missense possibly damaging 0.95
R5540:Myh8 UTSW 11 67286440 missense probably benign 0.00
R5726:Myh8 UTSW 11 67294566 missense possibly damaging 0.79
R5770:Myh8 UTSW 11 67297200 missense probably damaging 1.00
R6135:Myh8 UTSW 11 67297500 missense possibly damaging 0.51
R6253:Myh8 UTSW 11 67301967 missense probably benign 0.06
R6318:Myh8 UTSW 11 67299341 missense probably benign 0.00
R6432:Myh8 UTSW 11 67298579 missense probably benign 0.01
R6452:Myh8 UTSW 11 67292449 missense probably benign 0.27
R6452:Myh8 UTSW 11 67305739 missense possibly damaging 0.88
R6512:Myh8 UTSW 11 67289662 nonsense probably null
R6714:Myh8 UTSW 11 67306949 missense probably damaging 1.00
R6842:Myh8 UTSW 11 67284655 missense probably damaging 1.00
R7007:Myh8 UTSW 11 67288316 missense probably benign 0.03
R7025:Myh8 UTSW 11 67297539 missense probably benign 0.02
R7086:Myh8 UTSW 11 67292627 splice site probably null
R7098:Myh8 UTSW 11 67279053 missense probably benign 0.03
R7716:Myh8 UTSW 11 67298652 missense possibly damaging 0.51
R7765:Myh8 UTSW 11 67303655 missense probably benign 0.44
R7825:Myh8 UTSW 11 67303712 missense possibly damaging 0.94
R7921:Myh8 UTSW 11 67283818 missense probably damaging 0.97
R7926:Myh8 UTSW 11 67278906 missense possibly damaging 0.94
R7932:Myh8 UTSW 11 67294604 missense probably benign 0.00
R8003:Myh8 UTSW 11 67299760 missense probably damaging 1.00
R8028:Myh8 UTSW 11 67303676 missense possibly damaging 0.65
R8121:Myh8 UTSW 11 67289821 missense probably benign 0.00
R8125:Myh8 UTSW 11 67299772 missense possibly damaging 0.94
R8170:Myh8 UTSW 11 67288266 missense probably benign 0.30
R8277:Myh8 UTSW 11 67292909 missense probably benign 0.10
R8304:Myh8 UTSW 11 67304336 missense possibly damaging 0.72
R8431:Myh8 UTSW 11 67283614 missense possibly damaging 0.94
R8535:Myh8 UTSW 11 67278915 missense probably damaging 1.00
R8795:Myh8 UTSW 11 67283377 critical splice acceptor site probably benign
R8858:Myh8 UTSW 11 67301994 missense possibly damaging 0.67
R8928:Myh8 UTSW 11 67283255 missense probably benign 0.10
T0722:Myh8 UTSW 11 67304436 missense probably benign 0.41
Z1088:Myh8 UTSW 11 67298592 missense probably damaging 1.00
Z1176:Myh8 UTSW 11 67303674 missense probably damaging 1.00
Z1177:Myh8 UTSW 11 67301424 missense probably damaging 0.99
Z1177:Myh8 UTSW 11 67308355 missense possibly damaging 0.64
Z1187:Myh8 UTSW 11 67297486 missense probably benign
Z1188:Myh8 UTSW 11 67297486 missense probably benign
Z1190:Myh8 UTSW 11 67297486 missense probably benign
Z1191:Myh8 UTSW 11 67297486 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGAGAACCAGTCCATCCTGATC -3'
(R):5'- GAGTTGTCATTCCTCACGGTC -3'

Sequencing Primer
(F):5'- ACCAGTCCATCCTGATCACGTATG -3'
(R):5'- GTTCCCAAAGGCCTCCAG -3'
Posted On2019-10-17