Incidental Mutation 'R7498:Akap6'
ID 581230
Institutional Source Beutler Lab
Gene Symbol Akap6
Ensembl Gene ENSMUSG00000061603
Gene Name A kinase anchor protein 6
Synonyms
MMRRC Submission 045571-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.776) question?
Stock # R7498 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 52746166-53202382 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 53189488 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 2301 (R2301*)
Ref Sequence ENSEMBL: ENSMUSP00000093406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095737] [ENSMUST00000219786]
AlphaFold E9Q9K8
Predicted Effect probably null
Transcript: ENSMUST00000095737
AA Change: R2301*
SMART Domains Protein: ENSMUSP00000093406
Gene: ENSMUSG00000061603
AA Change: R2301*

DomainStartEndE-ValueType
low complexity region 34 51 N/A INTRINSIC
Blast:SPEC 66 168 2e-50 BLAST
low complexity region 441 455 N/A INTRINSIC
low complexity region 544 555 N/A INTRINSIC
low complexity region 569 587 N/A INTRINSIC
low complexity region 640 651 N/A INTRINSIC
low complexity region 694 708 N/A INTRINSIC
SPEC 779 880 1.06e-1 SMART
SPEC 959 1057 1.45e0 SMART
SPEC 1078 1185 2.56e-2 SMART
low complexity region 1316 1332 N/A INTRINSIC
low complexity region 1555 1568 N/A INTRINSIC
low complexity region 1610 1622 N/A INTRINSIC
low complexity region 1683 1698 N/A INTRINSIC
low complexity region 1737 1781 N/A INTRINSIC
low complexity region 1899 1910 N/A INTRINSIC
low complexity region 2019 2031 N/A INTRINSIC
low complexity region 2104 2115 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219786
Meta Mutation Damage Score 0.9712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein is highly expressed in various brain regions and cardiac and skeletal muscle. It is specifically localized to the sarcoplasmic reticulum and nuclear membrane, and is involved in anchoring PKA to the nuclear membrane or sarcoplasmic reticulum. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in partial embryonic lethality; surviving homozygotes display a decreased body weight, craniofacial defects and reduced viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik G A 2: 68,498,012 (GRCm39) E148K unknown Het
Adgrl2 T A 3: 148,564,852 (GRCm39) K243* probably null Het
Adgrv1 A T 13: 81,588,344 (GRCm39) V4414E possibly damaging Het
Ahnak A T 19: 8,989,383 (GRCm39) I3556F probably benign Het
Alg6 A G 4: 99,636,933 (GRCm39) T305A probably damaging Het
Alpk1 C T 3: 127,473,427 (GRCm39) A859T probably benign Het
Apba3 T A 10: 81,104,735 (GRCm39) F3I possibly damaging Het
Birc6 A G 17: 74,967,465 (GRCm39) E4151G probably damaging Het
Bmp2k T A 5: 97,235,978 (GRCm39) F1134I probably benign Het
C6 A T 15: 4,792,846 (GRCm39) H317L probably damaging Het
Catsperg2 G A 7: 29,416,527 (GRCm39) S295L possibly damaging Het
Ccdc142 G T 6: 83,080,212 (GRCm39) R385L possibly damaging Het
Ciz1 A T 2: 32,261,761 (GRCm39) M482L probably benign Het
Crisp3 A G 17: 40,536,693 (GRCm39) probably null Het
Dcaf15 G A 8: 84,828,392 (GRCm39) P233S probably damaging Het
Def8 A G 8: 124,174,583 (GRCm39) N16S probably damaging Het
Dnah7b T G 1: 46,364,925 (GRCm39) S3569A probably damaging Het
Dok6 C T 18: 89,787,443 (GRCm39) probably benign Het
Dop1a A T 9: 86,376,464 (GRCm39) T233S possibly damaging Het
Ep300 T A 15: 81,524,044 (GRCm39) V1325D unknown Het
Fancm T A 12: 65,146,165 (GRCm39) H629Q probably benign Het
Fbxo10 T C 4: 45,062,194 (GRCm39) S111G probably benign Het
Fbxo21 T C 5: 118,140,239 (GRCm39) probably null Het
Fdx1 A C 9: 51,859,898 (GRCm39) L144R probably damaging Het
Fgfr3 GGACCTCTCCGTG GG 5: 33,892,766 (GRCm39) probably null Het
Flot2 G A 11: 77,944,188 (GRCm39) probably null Het
Fndc10 C T 4: 155,779,195 (GRCm39) R80C probably damaging Het
Fut8 A T 12: 77,459,708 (GRCm39) T274S probably benign Het
Gli2 T C 1: 118,763,565 (GRCm39) M1529V possibly damaging Het
Gm7361 C A 5: 26,466,188 (GRCm39) H183Q probably benign Het
Hdlbp T A 1: 93,341,337 (GRCm39) H1007L probably benign Het
Hmcn2 A C 2: 31,273,487 (GRCm39) probably null Het
Inhbb C T 1: 119,345,608 (GRCm39) R227H probably damaging Het
Kifc1 A G 17: 34,102,846 (GRCm39) F256L probably benign Het
Lman2 A T 13: 55,494,790 (GRCm39) F326Y probably damaging Het
Mcmdc2 T C 1: 9,989,302 (GRCm39) V242A probably benign Het
Mettl8 A C 2: 70,795,969 (GRCm39) V306G probably damaging Het
Mog A T 17: 37,322,984 (GRCm39) probably null Het
Morc2b G A 17: 33,356,833 (GRCm39) A313V possibly damaging Het
Myh3 A G 11: 66,987,874 (GRCm39) N1449S possibly damaging Het
Myh8 C A 11: 67,174,263 (GRCm39) T200K possibly damaging Het
Myo16 T A 8: 10,450,589 (GRCm39) H530Q unknown Het
Neb C T 2: 52,148,188 (GRCm39) R2686H probably damaging Het
Nudt2 T C 4: 41,480,539 (GRCm39) F141L possibly damaging Het
Obscn G A 11: 58,973,539 (GRCm39) H1931Y probably damaging Het
Odad3 A G 9: 21,913,553 (GRCm39) I73T probably damaging Het
Or10al5 A G 17: 38,063,242 (GRCm39) T166A probably damaging Het
Or2d4 A T 7: 106,543,575 (GRCm39) V211D possibly damaging Het
Or5p80 T A 7: 108,229,623 (GRCm39) C141* probably null Het
Plcb1 T A 2: 135,104,153 (GRCm39) L274* probably null Het
Plcb1 G T 2: 135,104,154 (GRCm39) L274F probably damaging Het
Potefam3d A C 8: 69,972,475 (GRCm39) Y91* probably null Het
Prc1 C T 7: 79,962,898 (GRCm39) T564M possibly damaging Het
Psd4 G A 2: 24,296,996 (GRCm39) R923Q probably damaging Het
Ptprj G A 2: 90,266,909 (GRCm39) Q1300* probably null Het
Rapgef6 G T 11: 54,510,830 (GRCm39) R249L probably damaging Het
Slain1 G A 14: 103,893,429 (GRCm39) probably null Het
Slfn9 A T 11: 82,873,013 (GRCm39) I630N probably damaging Het
Smg6 G A 11: 74,819,932 (GRCm39) A68T probably benign Het
Spata31h1 T A 10: 82,127,113 (GRCm39) T1966S probably benign Het
Spef2 T A 15: 9,727,625 (GRCm39) M153L probably benign Het
St8sia4 T A 1: 95,519,418 (GRCm39) M357L probably benign Het
Tal1 A T 4: 114,925,879 (GRCm39) H316L possibly damaging Het
Tenm4 A G 7: 96,497,224 (GRCm39) E1207G probably damaging Het
Tmem64 C A 4: 15,266,176 (GRCm39) H75Q probably benign Het
Tor4a A G 2: 25,085,804 (GRCm39) V33A probably benign Het
Traj52 C T 14: 54,402,818 (GRCm39) T15I Het
Trim50 G A 5: 135,392,768 (GRCm39) V228M probably benign Het
Trpm1 A T 7: 63,858,657 (GRCm39) I360F possibly damaging Het
Trpm6 A T 19: 18,853,484 (GRCm39) R1835W probably damaging Het
Ubn1 T C 16: 4,894,969 (GRCm39) S672P probably damaging Het
Ugt2a2 C T 5: 87,622,500 (GRCm39) C156Y probably damaging Het
Wnk1 T C 6: 119,904,157 (GRCm39) S2223G unknown Het
Wnt7b G T 15: 85,427,880 (GRCm39) A194E probably damaging Het
Zmpste24 A G 4: 120,940,028 (GRCm39) V206A probably benign Het
Other mutations in Akap6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Akap6 APN 12 53,187,763 (GRCm39) missense possibly damaging 0.79
IGL00505:Akap6 APN 12 52,933,885 (GRCm39) missense possibly damaging 0.92
IGL01134:Akap6 APN 12 52,984,000 (GRCm39) missense probably damaging 0.96
IGL01458:Akap6 APN 12 52,933,601 (GRCm39) nonsense probably null
IGL01589:Akap6 APN 12 53,186,447 (GRCm39) missense probably damaging 1.00
IGL01592:Akap6 APN 12 53,188,925 (GRCm39) missense probably damaging 1.00
IGL01738:Akap6 APN 12 52,933,600 (GRCm39) missense probably damaging 0.99
IGL01867:Akap6 APN 12 52,934,791 (GRCm39) missense probably damaging 1.00
IGL02025:Akap6 APN 12 53,187,118 (GRCm39) missense probably benign
IGL02041:Akap6 APN 12 53,187,436 (GRCm39) missense probably damaging 1.00
IGL02058:Akap6 APN 12 53,187,338 (GRCm39) missense probably damaging 1.00
IGL02194:Akap6 APN 12 52,933,606 (GRCm39) missense probably benign 0.00
IGL02226:Akap6 APN 12 53,057,250 (GRCm39) splice site probably benign
IGL02323:Akap6 APN 12 53,187,212 (GRCm39) missense probably benign 0.00
IGL02449:Akap6 APN 12 53,186,971 (GRCm39) missense probably damaging 1.00
IGL02475:Akap6 APN 12 53,186,277 (GRCm39) missense probably benign 0.03
IGL02546:Akap6 APN 12 52,927,521 (GRCm39) missense probably damaging 1.00
IGL02547:Akap6 APN 12 53,187,479 (GRCm39) missense probably damaging 1.00
IGL02588:Akap6 APN 12 52,933,282 (GRCm39) nonsense probably null
IGL02608:Akap6 APN 12 53,057,389 (GRCm39) missense probably benign 0.39
IGL02884:Akap6 APN 12 52,933,405 (GRCm39) missense probably benign 0.00
IGL02945:Akap6 APN 12 52,927,620 (GRCm39) missense probably damaging 1.00
IGL03029:Akap6 APN 12 52,933,195 (GRCm39) missense probably damaging 1.00
IGL03129:Akap6 APN 12 53,187,089 (GRCm39) missense probably damaging 1.00
R0133:Akap6 UTSW 12 53,186,254 (GRCm39) nonsense probably null
R0166:Akap6 UTSW 12 53,187,707 (GRCm39) missense probably benign 0.04
R0189:Akap6 UTSW 12 53,188,037 (GRCm39) missense probably benign 0.41
R0532:Akap6 UTSW 12 52,934,766 (GRCm39) missense probably benign 0.00
R0632:Akap6 UTSW 12 52,983,931 (GRCm39) missense probably damaging 1.00
R0666:Akap6 UTSW 12 52,958,591 (GRCm39) missense probably damaging 1.00
R0723:Akap6 UTSW 12 53,188,685 (GRCm39) missense probably damaging 1.00
R0763:Akap6 UTSW 12 53,188,997 (GRCm39) missense possibly damaging 0.93
R0785:Akap6 UTSW 12 52,933,405 (GRCm39) missense probably benign 0.00
R0879:Akap6 UTSW 12 52,927,582 (GRCm39) missense probably damaging 1.00
R0880:Akap6 UTSW 12 53,186,291 (GRCm39) missense possibly damaging 0.93
R1033:Akap6 UTSW 12 53,116,005 (GRCm39) missense probably damaging 0.97
R1055:Akap6 UTSW 12 52,927,455 (GRCm39) nonsense probably null
R1199:Akap6 UTSW 12 52,842,973 (GRCm39) missense probably damaging 1.00
R1295:Akap6 UTSW 12 52,933,812 (GRCm39) missense probably damaging 1.00
R1389:Akap6 UTSW 12 53,186,303 (GRCm39) missense probably benign 0.15
R1471:Akap6 UTSW 12 53,188,279 (GRCm39) missense probably benign 0.05
R1483:Akap6 UTSW 12 52,842,870 (GRCm39) missense probably damaging 1.00
R1512:Akap6 UTSW 12 52,983,937 (GRCm39) missense probably damaging 1.00
R1648:Akap6 UTSW 12 53,188,789 (GRCm39) nonsense probably null
R1791:Akap6 UTSW 12 53,115,908 (GRCm39) missense probably damaging 1.00
R1888:Akap6 UTSW 12 53,188,958 (GRCm39) missense possibly damaging 0.88
R1888:Akap6 UTSW 12 53,188,958 (GRCm39) missense possibly damaging 0.88
R1891:Akap6 UTSW 12 53,188,958 (GRCm39) missense possibly damaging 0.88
R1899:Akap6 UTSW 12 53,188,635 (GRCm39) missense possibly damaging 0.95
R1917:Akap6 UTSW 12 53,151,395 (GRCm39) missense probably benign 0.13
R1970:Akap6 UTSW 12 52,985,258 (GRCm39) missense probably damaging 0.96
R1987:Akap6 UTSW 12 53,187,578 (GRCm39) missense possibly damaging 0.78
R1988:Akap6 UTSW 12 53,187,578 (GRCm39) missense possibly damaging 0.78
R2153:Akap6 UTSW 12 53,188,187 (GRCm39) missense probably benign 0.03
R2567:Akap6 UTSW 12 52,985,156 (GRCm39) missense probably damaging 1.00
R2568:Akap6 UTSW 12 52,934,061 (GRCm39) missense possibly damaging 0.77
R3025:Akap6 UTSW 12 53,186,926 (GRCm39) missense probably benign
R3051:Akap6 UTSW 12 52,933,816 (GRCm39) missense probably damaging 1.00
R3195:Akap6 UTSW 12 53,119,240 (GRCm39) nonsense probably null
R3196:Akap6 UTSW 12 53,119,240 (GRCm39) nonsense probably null
R3426:Akap6 UTSW 12 52,934,817 (GRCm39) missense probably damaging 1.00
R3783:Akap6 UTSW 12 52,927,552 (GRCm39) missense probably damaging 1.00
R3934:Akap6 UTSW 12 53,187,227 (GRCm39) missense possibly damaging 0.92
R3936:Akap6 UTSW 12 53,187,227 (GRCm39) missense possibly damaging 0.92
R3967:Akap6 UTSW 12 53,188,236 (GRCm39) missense probably damaging 1.00
R3970:Akap6 UTSW 12 53,188,236 (GRCm39) missense probably damaging 1.00
R4042:Akap6 UTSW 12 53,186,162 (GRCm39) critical splice acceptor site probably null
R4095:Akap6 UTSW 12 53,186,245 (GRCm39) missense probably damaging 1.00
R4152:Akap6 UTSW 12 53,187,190 (GRCm39) missense probably benign 0.45
R4231:Akap6 UTSW 12 53,187,821 (GRCm39) missense probably damaging 1.00
R4232:Akap6 UTSW 12 53,186,454 (GRCm39) missense probably damaging 1.00
R4233:Akap6 UTSW 12 53,186,454 (GRCm39) missense probably damaging 1.00
R4234:Akap6 UTSW 12 53,186,454 (GRCm39) missense probably damaging 1.00
R4235:Akap6 UTSW 12 53,186,454 (GRCm39) missense probably damaging 1.00
R4236:Akap6 UTSW 12 53,186,454 (GRCm39) missense probably damaging 1.00
R4475:Akap6 UTSW 12 53,188,426 (GRCm39) missense probably benign 0.00
R4513:Akap6 UTSW 12 52,842,787 (GRCm39) missense probably benign 0.03
R4686:Akap6 UTSW 12 52,934,406 (GRCm39) frame shift probably null
R4724:Akap6 UTSW 12 52,842,668 (GRCm39) missense possibly damaging 0.80
R4782:Akap6 UTSW 12 52,934,406 (GRCm39) frame shift probably null
R4852:Akap6 UTSW 12 53,151,458 (GRCm39) missense probably damaging 1.00
R5024:Akap6 UTSW 12 53,189,345 (GRCm39) missense probably benign 0.01
R5116:Akap6 UTSW 12 53,188,298 (GRCm39) missense probably benign 0.01
R5164:Akap6 UTSW 12 53,189,249 (GRCm39) missense probably benign
R5225:Akap6 UTSW 12 52,933,329 (GRCm39) missense probably damaging 1.00
R5269:Akap6 UTSW 12 53,186,626 (GRCm39) missense probably damaging 0.99
R5352:Akap6 UTSW 12 52,842,880 (GRCm39) missense probably damaging 1.00
R5496:Akap6 UTSW 12 53,187,436 (GRCm39) missense possibly damaging 0.87
R5551:Akap6 UTSW 12 52,842,747 (GRCm39) missense probably damaging 1.00
R5997:Akap6 UTSW 12 52,984,016 (GRCm39) critical splice donor site probably null
R6137:Akap6 UTSW 12 53,187,137 (GRCm39) missense probably damaging 1.00
R6151:Akap6 UTSW 12 53,072,575 (GRCm39) missense probably damaging 1.00
R6169:Akap6 UTSW 12 53,189,141 (GRCm39) missense probably benign
R6307:Akap6 UTSW 12 53,188,351 (GRCm39) missense possibly damaging 0.85
R6351:Akap6 UTSW 12 53,188,808 (GRCm39) missense probably damaging 0.98
R6479:Akap6 UTSW 12 53,187,952 (GRCm39) missense probably damaging 1.00
R6502:Akap6 UTSW 12 53,186,998 (GRCm39) missense probably damaging 1.00
R6760:Akap6 UTSW 12 53,186,561 (GRCm39) missense probably damaging 1.00
R6778:Akap6 UTSW 12 53,072,599 (GRCm39) missense probably damaging 1.00
R6837:Akap6 UTSW 12 53,188,045 (GRCm39) missense probably damaging 1.00
R6896:Akap6 UTSW 12 52,934,277 (GRCm39) missense probably benign 0.06
R6917:Akap6 UTSW 12 53,115,951 (GRCm39) missense probably null 0.97
R6983:Akap6 UTSW 12 52,934,436 (GRCm39) missense probably damaging 1.00
R7142:Akap6 UTSW 12 52,934,147 (GRCm39) missense probably benign 0.02
R7143:Akap6 UTSW 12 52,934,147 (GRCm39) missense probably benign 0.02
R7216:Akap6 UTSW 12 53,187,240 (GRCm39) missense probably benign 0.02
R7297:Akap6 UTSW 12 52,934,147 (GRCm39) missense probably benign 0.02
R7356:Akap6 UTSW 12 52,958,647 (GRCm39) missense probably damaging 1.00
R7378:Akap6 UTSW 12 53,189,357 (GRCm39) missense probably benign 0.00
R7382:Akap6 UTSW 12 53,188,954 (GRCm39) missense probably benign 0.00
R7542:Akap6 UTSW 12 53,116,017 (GRCm39) missense probably damaging 1.00
R7589:Akap6 UTSW 12 53,188,846 (GRCm39) nonsense probably null
R7676:Akap6 UTSW 12 52,933,633 (GRCm39) missense possibly damaging 0.94
R7814:Akap6 UTSW 12 53,187,744 (GRCm39) missense probably benign 0.28
R7971:Akap6 UTSW 12 53,186,578 (GRCm39) missense probably damaging 1.00
R8039:Akap6 UTSW 12 53,188,459 (GRCm39) missense probably benign 0.00
R8425:Akap6 UTSW 12 52,933,404 (GRCm39) missense probably benign 0.00
R8747:Akap6 UTSW 12 53,188,999 (GRCm39) missense probably benign 0.01
R8885:Akap6 UTSW 12 53,188,319 (GRCm39) missense probably benign
R8956:Akap6 UTSW 12 53,187,127 (GRCm39) missense probably benign 0.00
R8989:Akap6 UTSW 12 52,927,654 (GRCm39) missense probably damaging 1.00
R9014:Akap6 UTSW 12 53,186,403 (GRCm39) missense possibly damaging 0.60
R9031:Akap6 UTSW 12 53,188,831 (GRCm39) missense probably benign 0.36
R9216:Akap6 UTSW 12 52,927,668 (GRCm39) missense probably benign 0.05
R9220:Akap6 UTSW 12 53,187,232 (GRCm39) missense possibly damaging 0.49
R9243:Akap6 UTSW 12 53,188,035 (GRCm39) missense probably benign 0.08
R9286:Akap6 UTSW 12 53,119,254 (GRCm39) missense possibly damaging 0.90
R9347:Akap6 UTSW 12 53,115,894 (GRCm39) missense probably damaging 1.00
R9475:Akap6 UTSW 12 53,057,335 (GRCm39) missense probably damaging 1.00
R9509:Akap6 UTSW 12 53,189,021 (GRCm39) missense probably damaging 0.99
R9523:Akap6 UTSW 12 52,842,672 (GRCm39) missense probably benign 0.02
R9600:Akap6 UTSW 12 52,933,341 (GRCm39) missense probably benign 0.04
R9612:Akap6 UTSW 12 52,958,690 (GRCm39) missense probably damaging 1.00
R9627:Akap6 UTSW 12 53,151,413 (GRCm39) missense
R9666:Akap6 UTSW 12 53,188,318 (GRCm39) missense probably benign
R9784:Akap6 UTSW 12 53,187,853 (GRCm39) missense probably damaging 1.00
X0062:Akap6 UTSW 12 53,189,144 (GRCm39) missense probably benign 0.43
Z1176:Akap6 UTSW 12 53,187,227 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGACACGGTGCCTCTTTCAG -3'
(R):5'- AGCTAATCATGCTGACCAGTC -3'

Sequencing Primer
(F):5'- TCAGGACTTTCCCCTCAGAAGG -3'
(R):5'- GCTGACCAGTCTTCTATAGTGGATC -3'
Posted On 2019-10-17