Incidental Mutation 'R7498:Trpm6'
ID 581248
Institutional Source Beutler Lab
Gene Symbol Trpm6
Ensembl Gene ENSMUSG00000024727
Gene Name transient receptor potential cation channel, subfamily M, member 6
Synonyms CHAK2
MMRRC Submission 045571-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7498 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 18727347-18869875 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 18853484 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 1835 (R1835W)
Ref Sequence ENSEMBL: ENSMUSP00000037443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040489]
AlphaFold Q8CIR4
Predicted Effect probably damaging
Transcript: ENSMUST00000040489
AA Change: R1835W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037443
Gene: ENSMUSG00000024727
AA Change: R1835W

DomainStartEndE-ValueType
Blast:ANK 430 459 4e-8 BLAST
low complexity region 580 604 N/A INTRINSIC
transmembrane domain 749 766 N/A INTRINSIC
Pfam:Ion_trans 847 1087 2.8e-13 PFAM
low complexity region 1113 1126 N/A INTRINSIC
low complexity region 1136 1154 N/A INTRINSIC
Pfam:TRPM_tetra 1176 1231 7.5e-27 PFAM
low complexity region 1320 1331 N/A INTRINSIC
low complexity region 1578 1596 N/A INTRINSIC
Blast:Alpha_kinase 1618 1673 9e-11 BLAST
low complexity region 1682 1695 N/A INTRINSIC
Alpha_kinase 1761 1978 1e-84 SMART
Meta Mutation Damage Score 0.3741 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predominantly expressed in the kidney and colon, and encodes a protein containing an ion channel domain and a protein kinase domain. It is crucial for magnesium homeostasis, and plays an essential role in epithelial magnesium transport and in the active magnesium absorption in the gut and kidney. Mutations in this gene are associated with hypomagnesemia with secondary hypocalcemia. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic and postnatal lethality with exencephaly, spina bifida occulta, and abnormal brain and facial development. Mice heterozygous for a knock-out allele exhibit some premature death and decreased serummagnesium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik G A 2: 68,498,012 (GRCm39) E148K unknown Het
Adgrl2 T A 3: 148,564,852 (GRCm39) K243* probably null Het
Adgrv1 A T 13: 81,588,344 (GRCm39) V4414E possibly damaging Het
Ahnak A T 19: 8,989,383 (GRCm39) I3556F probably benign Het
Akap6 C T 12: 53,189,488 (GRCm39) R2301* probably null Het
Alg6 A G 4: 99,636,933 (GRCm39) T305A probably damaging Het
Alpk1 C T 3: 127,473,427 (GRCm39) A859T probably benign Het
Apba3 T A 10: 81,104,735 (GRCm39) F3I possibly damaging Het
Birc6 A G 17: 74,967,465 (GRCm39) E4151G probably damaging Het
Bmp2k T A 5: 97,235,978 (GRCm39) F1134I probably benign Het
C6 A T 15: 4,792,846 (GRCm39) H317L probably damaging Het
Catsperg2 G A 7: 29,416,527 (GRCm39) S295L possibly damaging Het
Ccdc142 G T 6: 83,080,212 (GRCm39) R385L possibly damaging Het
Ciz1 A T 2: 32,261,761 (GRCm39) M482L probably benign Het
Crisp3 A G 17: 40,536,693 (GRCm39) probably null Het
Dcaf15 G A 8: 84,828,392 (GRCm39) P233S probably damaging Het
Def8 A G 8: 124,174,583 (GRCm39) N16S probably damaging Het
Dnah7b T G 1: 46,364,925 (GRCm39) S3569A probably damaging Het
Dok6 C T 18: 89,787,443 (GRCm39) probably benign Het
Dop1a A T 9: 86,376,464 (GRCm39) T233S possibly damaging Het
Ep300 T A 15: 81,524,044 (GRCm39) V1325D unknown Het
Fancm T A 12: 65,146,165 (GRCm39) H629Q probably benign Het
Fbxo10 T C 4: 45,062,194 (GRCm39) S111G probably benign Het
Fbxo21 T C 5: 118,140,239 (GRCm39) probably null Het
Fdx1 A C 9: 51,859,898 (GRCm39) L144R probably damaging Het
Fgfr3 GGACCTCTCCGTG GG 5: 33,892,766 (GRCm39) probably null Het
Flot2 G A 11: 77,944,188 (GRCm39) probably null Het
Fndc10 C T 4: 155,779,195 (GRCm39) R80C probably damaging Het
Fut8 A T 12: 77,459,708 (GRCm39) T274S probably benign Het
Gli2 T C 1: 118,763,565 (GRCm39) M1529V possibly damaging Het
Gm7361 C A 5: 26,466,188 (GRCm39) H183Q probably benign Het
Hdlbp T A 1: 93,341,337 (GRCm39) H1007L probably benign Het
Hmcn2 A C 2: 31,273,487 (GRCm39) probably null Het
Inhbb C T 1: 119,345,608 (GRCm39) R227H probably damaging Het
Kifc1 A G 17: 34,102,846 (GRCm39) F256L probably benign Het
Lman2 A T 13: 55,494,790 (GRCm39) F326Y probably damaging Het
Mcmdc2 T C 1: 9,989,302 (GRCm39) V242A probably benign Het
Mettl8 A C 2: 70,795,969 (GRCm39) V306G probably damaging Het
Mog A T 17: 37,322,984 (GRCm39) probably null Het
Morc2b G A 17: 33,356,833 (GRCm39) A313V possibly damaging Het
Myh3 A G 11: 66,987,874 (GRCm39) N1449S possibly damaging Het
Myh8 C A 11: 67,174,263 (GRCm39) T200K possibly damaging Het
Myo16 T A 8: 10,450,589 (GRCm39) H530Q unknown Het
Neb C T 2: 52,148,188 (GRCm39) R2686H probably damaging Het
Nudt2 T C 4: 41,480,539 (GRCm39) F141L possibly damaging Het
Obscn G A 11: 58,973,539 (GRCm39) H1931Y probably damaging Het
Odad3 A G 9: 21,913,553 (GRCm39) I73T probably damaging Het
Or10al5 A G 17: 38,063,242 (GRCm39) T166A probably damaging Het
Or2d4 A T 7: 106,543,575 (GRCm39) V211D possibly damaging Het
Or5p80 T A 7: 108,229,623 (GRCm39) C141* probably null Het
Plcb1 T A 2: 135,104,153 (GRCm39) L274* probably null Het
Plcb1 G T 2: 135,104,154 (GRCm39) L274F probably damaging Het
Potefam3d A C 8: 69,972,475 (GRCm39) Y91* probably null Het
Prc1 C T 7: 79,962,898 (GRCm39) T564M possibly damaging Het
Psd4 G A 2: 24,296,996 (GRCm39) R923Q probably damaging Het
Ptprj G A 2: 90,266,909 (GRCm39) Q1300* probably null Het
Rapgef6 G T 11: 54,510,830 (GRCm39) R249L probably damaging Het
Slain1 G A 14: 103,893,429 (GRCm39) probably null Het
Slfn9 A T 11: 82,873,013 (GRCm39) I630N probably damaging Het
Smg6 G A 11: 74,819,932 (GRCm39) A68T probably benign Het
Spata31h1 T A 10: 82,127,113 (GRCm39) T1966S probably benign Het
Spef2 T A 15: 9,727,625 (GRCm39) M153L probably benign Het
St8sia4 T A 1: 95,519,418 (GRCm39) M357L probably benign Het
Tal1 A T 4: 114,925,879 (GRCm39) H316L possibly damaging Het
Tenm4 A G 7: 96,497,224 (GRCm39) E1207G probably damaging Het
Tmem64 C A 4: 15,266,176 (GRCm39) H75Q probably benign Het
Tor4a A G 2: 25,085,804 (GRCm39) V33A probably benign Het
Traj52 C T 14: 54,402,818 (GRCm39) T15I Het
Trim50 G A 5: 135,392,768 (GRCm39) V228M probably benign Het
Trpm1 A T 7: 63,858,657 (GRCm39) I360F possibly damaging Het
Ubn1 T C 16: 4,894,969 (GRCm39) S672P probably damaging Het
Ugt2a2 C T 5: 87,622,500 (GRCm39) C156Y probably damaging Het
Wnk1 T C 6: 119,904,157 (GRCm39) S2223G unknown Het
Wnt7b G T 15: 85,427,880 (GRCm39) A194E probably damaging Het
Zmpste24 A G 4: 120,940,028 (GRCm39) V206A probably benign Het
Other mutations in Trpm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Trpm6 APN 19 18,761,272 (GRCm39) splice site probably benign
IGL00862:Trpm6 APN 19 18,804,892 (GRCm39) missense probably damaging 1.00
IGL01348:Trpm6 APN 19 18,855,015 (GRCm39) missense probably damaging 1.00
IGL01400:Trpm6 APN 19 18,803,158 (GRCm39) nonsense probably null
IGL01451:Trpm6 APN 19 18,786,933 (GRCm39) missense probably damaging 1.00
IGL01508:Trpm6 APN 19 18,773,894 (GRCm39) nonsense probably null
IGL01995:Trpm6 APN 19 18,807,691 (GRCm39) splice site probably benign
IGL02092:Trpm6 APN 19 18,749,695 (GRCm39) missense possibly damaging 0.59
IGL02152:Trpm6 APN 19 18,809,903 (GRCm39) missense possibly damaging 0.93
IGL02294:Trpm6 APN 19 18,831,427 (GRCm39) missense probably benign
IGL02329:Trpm6 APN 19 18,831,581 (GRCm39) missense probably benign 0.17
IGL02366:Trpm6 APN 19 18,755,874 (GRCm39) splice site probably benign
IGL02402:Trpm6 APN 19 18,764,120 (GRCm39) missense probably benign 0.18
IGL02457:Trpm6 APN 19 18,804,762 (GRCm39) nonsense probably null
IGL02457:Trpm6 APN 19 18,803,155 (GRCm39) missense probably damaging 1.00
IGL02684:Trpm6 APN 19 18,779,571 (GRCm39) splice site probably benign
IGL02705:Trpm6 APN 19 18,754,097 (GRCm39) critical splice donor site probably null
IGL02728:Trpm6 APN 19 18,787,016 (GRCm39) missense possibly damaging 0.71
IGL02742:Trpm6 APN 19 18,807,376 (GRCm39) splice site probably benign
IGL02818:Trpm6 APN 19 18,843,621 (GRCm39) missense probably benign 0.04
IGL02836:Trpm6 APN 19 18,790,846 (GRCm39) missense probably damaging 1.00
IGL03119:Trpm6 APN 19 18,815,381 (GRCm39) nonsense probably null
IGL03193:Trpm6 APN 19 18,803,236 (GRCm39) missense possibly damaging 0.94
IGL03227:Trpm6 APN 19 18,764,143 (GRCm39) missense probably benign 0.12
IGL03227:Trpm6 APN 19 18,796,483 (GRCm39) missense probably benign 0.01
IGL03231:Trpm6 APN 19 18,796,545 (GRCm39) missense probably benign
IGL03245:Trpm6 APN 19 18,855,065 (GRCm39) missense probably damaging 1.00
IGL03328:Trpm6 APN 19 18,815,446 (GRCm39) missense possibly damaging 0.94
IGL03341:Trpm6 APN 19 18,790,850 (GRCm39) missense probably benign
P0043:Trpm6 UTSW 19 18,855,129 (GRCm39) missense probably damaging 1.00
PIT4260001:Trpm6 UTSW 19 18,803,166 (GRCm39) missense possibly damaging 0.48
R0057:Trpm6 UTSW 19 18,764,119 (GRCm39) missense probably benign 0.05
R0115:Trpm6 UTSW 19 18,807,316 (GRCm39) missense probably damaging 0.98
R0119:Trpm6 UTSW 19 18,809,957 (GRCm39) missense probably benign 0.05
R0140:Trpm6 UTSW 19 18,796,558 (GRCm39) splice site probably null
R0267:Trpm6 UTSW 19 18,800,742 (GRCm39) missense probably benign
R0350:Trpm6 UTSW 19 18,861,321 (GRCm39) splice site probably null
R0373:Trpm6 UTSW 19 18,830,951 (GRCm39) missense probably benign 0.15
R0393:Trpm6 UTSW 19 18,756,008 (GRCm39) missense probably damaging 0.99
R0416:Trpm6 UTSW 19 18,760,389 (GRCm39) splice site probably benign
R0505:Trpm6 UTSW 19 18,851,266 (GRCm39) splice site probably benign
R0526:Trpm6 UTSW 19 18,770,240 (GRCm39) missense probably damaging 0.97
R0607:Trpm6 UTSW 19 18,849,585 (GRCm39) missense probably benign 0.00
R0609:Trpm6 UTSW 19 18,803,226 (GRCm39) missense probably damaging 0.97
R0714:Trpm6 UTSW 19 18,815,451 (GRCm39) missense possibly damaging 0.90
R1215:Trpm6 UTSW 19 18,773,862 (GRCm39) missense probably damaging 1.00
R1474:Trpm6 UTSW 19 18,773,859 (GRCm39) missense probably benign 0.28
R1512:Trpm6 UTSW 19 18,853,295 (GRCm39) missense probably benign
R1558:Trpm6 UTSW 19 18,764,192 (GRCm39) missense probably benign 0.04
R1597:Trpm6 UTSW 19 18,804,888 (GRCm39) missense probably damaging 0.98
R1618:Trpm6 UTSW 19 18,854,995 (GRCm39) missense possibly damaging 0.88
R1779:Trpm6 UTSW 19 18,833,581 (GRCm39) missense probably damaging 1.00
R1796:Trpm6 UTSW 19 18,804,931 (GRCm39) missense possibly damaging 0.90
R1799:Trpm6 UTSW 19 18,869,363 (GRCm39) splice site probably null
R1840:Trpm6 UTSW 19 18,843,631 (GRCm39) missense probably benign 0.21
R1991:Trpm6 UTSW 19 18,773,648 (GRCm39) missense probably benign 0.00
R2030:Trpm6 UTSW 19 18,831,629 (GRCm39) missense probably benign
R2073:Trpm6 UTSW 19 18,853,406 (GRCm39) missense probably damaging 1.00
R2074:Trpm6 UTSW 19 18,855,103 (GRCm39) missense probably damaging 1.00
R2096:Trpm6 UTSW 19 18,803,116 (GRCm39) missense probably damaging 0.97
R2103:Trpm6 UTSW 19 18,773,648 (GRCm39) missense probably benign 0.00
R2106:Trpm6 UTSW 19 18,790,714 (GRCm39) missense possibly damaging 0.95
R2117:Trpm6 UTSW 19 18,807,316 (GRCm39) missense probably damaging 0.98
R2850:Trpm6 UTSW 19 18,769,454 (GRCm39) missense possibly damaging 0.68
R3125:Trpm6 UTSW 19 18,831,795 (GRCm39) missense probably benign 0.05
R3719:Trpm6 UTSW 19 18,749,757 (GRCm39) nonsense probably null
R3779:Trpm6 UTSW 19 18,853,403 (GRCm39) missense possibly damaging 0.80
R4115:Trpm6 UTSW 19 18,809,921 (GRCm39) missense probably damaging 1.00
R4367:Trpm6 UTSW 19 18,804,889 (GRCm39) missense probably damaging 0.99
R4523:Trpm6 UTSW 19 18,773,864 (GRCm39) missense probably damaging 1.00
R4546:Trpm6 UTSW 19 18,809,841 (GRCm39) missense probably damaging 1.00
R4564:Trpm6 UTSW 19 18,809,961 (GRCm39) missense possibly damaging 0.95
R4565:Trpm6 UTSW 19 18,803,236 (GRCm39) missense probably damaging 1.00
R4697:Trpm6 UTSW 19 18,831,155 (GRCm39) missense probably benign 0.01
R4714:Trpm6 UTSW 19 18,831,564 (GRCm39) missense possibly damaging 0.93
R4750:Trpm6 UTSW 19 18,853,428 (GRCm39) missense probably damaging 0.99
R4771:Trpm6 UTSW 19 18,790,857 (GRCm39) missense probably damaging 0.97
R4791:Trpm6 UTSW 19 18,845,345 (GRCm39) missense probably benign 0.00
R4814:Trpm6 UTSW 19 18,839,576 (GRCm39) missense probably benign 0.11
R5028:Trpm6 UTSW 19 18,764,124 (GRCm39) missense probably damaging 1.00
R5237:Trpm6 UTSW 19 18,790,828 (GRCm39) missense probably damaging 1.00
R5615:Trpm6 UTSW 19 18,807,297 (GRCm39) missense probably damaging 0.96
R5642:Trpm6 UTSW 19 18,807,571 (GRCm39) missense probably damaging 1.00
R5645:Trpm6 UTSW 19 18,830,968 (GRCm39) missense probably damaging 1.00
R5726:Trpm6 UTSW 19 18,830,981 (GRCm39) missense probably damaging 1.00
R5832:Trpm6 UTSW 19 18,764,183 (GRCm39) missense possibly damaging 0.66
R5843:Trpm6 UTSW 19 18,833,539 (GRCm39) missense probably benign 0.04
R5955:Trpm6 UTSW 19 18,869,383 (GRCm39) missense possibly damaging 0.75
R6101:Trpm6 UTSW 19 18,831,112 (GRCm39) nonsense probably null
R6105:Trpm6 UTSW 19 18,831,112 (GRCm39) nonsense probably null
R6211:Trpm6 UTSW 19 18,760,492 (GRCm39) missense probably damaging 1.00
R6228:Trpm6 UTSW 19 18,831,655 (GRCm39) missense probably damaging 1.00
R6263:Trpm6 UTSW 19 18,831,472 (GRCm39) missense possibly damaging 0.94
R6453:Trpm6 UTSW 19 18,807,354 (GRCm39) missense probably damaging 1.00
R6562:Trpm6 UTSW 19 18,815,406 (GRCm39) missense probably damaging 1.00
R6624:Trpm6 UTSW 19 18,866,384 (GRCm39) missense probably damaging 1.00
R6624:Trpm6 UTSW 19 18,773,803 (GRCm39) critical splice acceptor site probably null
R6729:Trpm6 UTSW 19 18,807,661 (GRCm39) missense probably damaging 1.00
R6765:Trpm6 UTSW 19 18,855,129 (GRCm39) missense probably damaging 1.00
R6976:Trpm6 UTSW 19 18,760,527 (GRCm39) missense probably benign
R7103:Trpm6 UTSW 19 18,790,911 (GRCm39) missense possibly damaging 0.87
R7126:Trpm6 UTSW 19 18,831,397 (GRCm39) nonsense probably null
R7128:Trpm6 UTSW 19 18,789,137 (GRCm39) missense possibly damaging 0.92
R7157:Trpm6 UTSW 19 18,815,462 (GRCm39) missense possibly damaging 0.91
R7212:Trpm6 UTSW 19 18,831,155 (GRCm39) missense probably benign 0.01
R7263:Trpm6 UTSW 19 18,854,150 (GRCm39) missense probably damaging 1.00
R7268:Trpm6 UTSW 19 18,755,949 (GRCm39) missense probably benign 0.13
R7305:Trpm6 UTSW 19 18,853,455 (GRCm39) missense probably benign 0.30
R7558:Trpm6 UTSW 19 18,756,029 (GRCm39) missense probably damaging 0.96
R7590:Trpm6 UTSW 19 18,809,945 (GRCm39) missense probably benign 0.31
R7646:Trpm6 UTSW 19 18,845,325 (GRCm39) missense probably benign 0.10
R7650:Trpm6 UTSW 19 18,853,377 (GRCm39) missense possibly damaging 0.70
R7727:Trpm6 UTSW 19 18,831,613 (GRCm39) missense probably damaging 0.97
R7743:Trpm6 UTSW 19 18,804,772 (GRCm39) missense probably benign 0.03
R7747:Trpm6 UTSW 19 18,727,409 (GRCm39) splice site probably null
R7807:Trpm6 UTSW 19 18,807,220 (GRCm39) missense probably benign 0.11
R7870:Trpm6 UTSW 19 18,792,605 (GRCm39) missense probably benign 0.01
R7891:Trpm6 UTSW 19 18,754,074 (GRCm39) missense probably benign 0.01
R7955:Trpm6 UTSW 19 18,831,654 (GRCm39) missense probably benign 0.01
R7965:Trpm6 UTSW 19 18,853,474 (GRCm39) missense probably damaging 1.00
R7967:Trpm6 UTSW 19 18,756,023 (GRCm39) missense probably damaging 0.99
R7992:Trpm6 UTSW 19 18,792,714 (GRCm39) missense probably damaging 1.00
R8035:Trpm6 UTSW 19 18,770,226 (GRCm39) missense probably damaging 0.97
R8108:Trpm6 UTSW 19 18,789,154 (GRCm39) missense probably damaging 1.00
R8268:Trpm6 UTSW 19 18,851,225 (GRCm39) missense possibly damaging 0.85
R8411:Trpm6 UTSW 19 18,831,332 (GRCm39) missense probably benign 0.39
R8413:Trpm6 UTSW 19 18,809,849 (GRCm39) missense probably benign 0.00
R8534:Trpm6 UTSW 19 18,869,459 (GRCm39) missense probably benign 0.00
R8932:Trpm6 UTSW 19 18,815,366 (GRCm39) missense possibly damaging 0.87
R8990:Trpm6 UTSW 19 18,792,799 (GRCm39) missense probably damaging 1.00
R9403:Trpm6 UTSW 19 18,810,016 (GRCm39) missense possibly damaging 0.84
R9446:Trpm6 UTSW 19 18,815,462 (GRCm39) missense possibly damaging 0.91
R9463:Trpm6 UTSW 19 18,761,264 (GRCm39) critical splice donor site probably null
R9485:Trpm6 UTSW 19 18,755,978 (GRCm39) missense probably benign 0.06
R9536:Trpm6 UTSW 19 18,764,123 (GRCm39) missense probably damaging 1.00
R9549:Trpm6 UTSW 19 18,853,394 (GRCm39) nonsense probably null
R9564:Trpm6 UTSW 19 18,851,240 (GRCm39) missense possibly damaging 0.92
R9626:Trpm6 UTSW 19 18,790,846 (GRCm39) missense probably damaging 1.00
R9655:Trpm6 UTSW 19 18,869,466 (GRCm39) missense probably benign
R9721:Trpm6 UTSW 19 18,807,336 (GRCm39) missense probably benign 0.12
R9742:Trpm6 UTSW 19 18,800,766 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TCAGGTGCTGTCACAAGAG -3'
(R):5'- TGCCAGGTTTCTAGACTGCC -3'

Sequencing Primer
(F):5'- GGAAATGGATGGGGGTCTCC -3'
(R):5'- TTCTACCACTCTACCCACAAAG -3'
Posted On 2019-10-17