Incidental Mutation 'R7498:Trpm6'
ID 581248
Institutional Source Beutler Lab
Gene Symbol Trpm6
Ensembl Gene ENSMUSG00000024727
Gene Name transient receptor potential cation channel, subfamily M, member 6
Synonyms CHAK2
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7498 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 18749983-18892510 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 18876120 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 1835 (R1835W)
Ref Sequence ENSEMBL: ENSMUSP00000037443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040489]
AlphaFold Q8CIR4
Predicted Effect probably damaging
Transcript: ENSMUST00000040489
AA Change: R1835W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037443
Gene: ENSMUSG00000024727
AA Change: R1835W

DomainStartEndE-ValueType
Blast:ANK 430 459 4e-8 BLAST
low complexity region 580 604 N/A INTRINSIC
transmembrane domain 749 766 N/A INTRINSIC
Pfam:Ion_trans 847 1087 2.8e-13 PFAM
low complexity region 1113 1126 N/A INTRINSIC
low complexity region 1136 1154 N/A INTRINSIC
Pfam:TRPM_tetra 1176 1231 7.5e-27 PFAM
low complexity region 1320 1331 N/A INTRINSIC
low complexity region 1578 1596 N/A INTRINSIC
Blast:Alpha_kinase 1618 1673 9e-11 BLAST
low complexity region 1682 1695 N/A INTRINSIC
Alpha_kinase 1761 1978 1e-84 SMART
Meta Mutation Damage Score 0.3741 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predominantly expressed in the kidney and colon, and encodes a protein containing an ion channel domain and a protein kinase domain. It is crucial for magnesium homeostasis, and plays an essential role in epithelial magnesium transport and in the active magnesium absorption in the gut and kidney. Mutations in this gene are associated with hypomagnesemia with secondary hypocalcemia. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic and postnatal lethality with exencephaly, spina bifida occulta, and abnormal brain and facial development. Mice heterozygous for a knock-out allele exhibit some premature death and decreased serummagnesium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik G A 2: 68,667,668 E148K unknown Het
4932415D10Rik T A 10: 82,291,279 T1966S probably benign Het
Adgrl2 T A 3: 148,859,216 K243* probably null Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Ahnak A T 19: 9,012,019 I3556F probably benign Het
Akap6 C T 12: 53,142,705 R2301* probably null Het
Alg6 A G 4: 99,748,696 T305A probably damaging Het
Alpk1 C T 3: 127,679,778 A859T probably benign Het
Apba3 T A 10: 81,268,901 F3I possibly damaging Het
Birc6 A G 17: 74,660,470 E4151G probably damaging Het
Bmp2k T A 5: 97,088,119 F1134I probably benign Het
C6 A T 15: 4,763,364 H317L probably damaging Het
Catsperg2 G A 7: 29,717,102 S295L possibly damaging Het
Ccdc142 G T 6: 83,103,231 R385L possibly damaging Het
Ccdc151 A G 9: 22,002,257 I73T probably damaging Het
Ciz1 A T 2: 32,371,749 M482L probably benign Het
Crisp3 A G 17: 40,225,802 probably null Het
Dcaf15 G A 8: 84,101,763 P233S probably damaging Het
Def8 A G 8: 123,447,844 N16S probably damaging Het
Dnah7b T G 1: 46,325,765 S3569A probably damaging Het
Dok6 C T 18: 89,769,319 probably benign Het
Dopey1 A T 9: 86,494,411 T233S possibly damaging Het
Ep300 T A 15: 81,639,843 V1325D unknown Het
Fancm T A 12: 65,099,391 H629Q probably benign Het
Fbxo10 T C 4: 45,062,194 S111G probably benign Het
Fbxo21 T C 5: 118,002,174 probably null Het
Fdx1 A C 9: 51,948,598 L144R probably damaging Het
Fgfr3 GGACCTCTCCGTG GG 5: 33,735,422 probably null Het
Flot2 G A 11: 78,053,362 probably null Het
Fndc10 C T 4: 155,694,738 R80C probably damaging Het
Fut8 A T 12: 77,412,934 T274S probably benign Het
Gli2 T C 1: 118,835,835 M1529V possibly damaging Het
Gm7361 C A 5: 26,261,190 H183Q probably benign Het
Gm7697 A C 8: 69,519,823 Y91* probably null Het
Hdlbp T A 1: 93,413,615 H1007L probably benign Het
Hmcn2 A C 2: 31,383,475 probably null Het
Inhbb C T 1: 119,417,878 R227H probably damaging Het
Kifc1 A G 17: 33,883,872 F256L probably benign Het
Lman2 A T 13: 55,346,977 F326Y probably damaging Het
Mcmdc2 T C 1: 9,919,077 V242A probably benign Het
Mettl8 A C 2: 70,965,625 V306G probably damaging Het
Mog A T 17: 37,012,092 probably null Het
Morc2b G A 17: 33,137,859 A313V possibly damaging Het
Myh3 A G 11: 67,097,048 N1449S possibly damaging Het
Myh8 C A 11: 67,283,437 T200K possibly damaging Het
Myo16 T A 8: 10,400,589 H530Q unknown Het
Neb C T 2: 52,258,176 R2686H probably damaging Het
Nudt2 T C 4: 41,480,539 F141L possibly damaging Het
Obscn G A 11: 59,082,713 H1931Y probably damaging Het
Olfr121 A G 17: 37,752,351 T166A probably damaging Het
Olfr508 T A 7: 108,630,416 C141* probably null Het
Olfr710 A T 7: 106,944,368 V211D possibly damaging Het
Plcb1 T A 2: 135,262,233 L274* probably null Het
Plcb1 G T 2: 135,262,234 L274F probably damaging Het
Prc1 C T 7: 80,313,150 T564M possibly damaging Het
Psd4 G A 2: 24,406,984 R923Q probably damaging Het
Ptprj G A 2: 90,436,565 Q1300* probably null Het
Rapgef6 G T 11: 54,620,004 R249L probably damaging Het
Slain1 G A 14: 103,655,993 probably null Het
Slfn9 A T 11: 82,982,187 I630N probably damaging Het
Smg6 G A 11: 74,929,106 A68T probably benign Het
Spef2 T A 15: 9,727,539 M153L probably benign Het
St8sia4 T A 1: 95,591,693 M357L probably benign Het
Tal1 A T 4: 115,068,682 H316L possibly damaging Het
Tenm4 A G 7: 96,848,017 E1207G probably damaging Het
Tmem64 C A 4: 15,266,176 H75Q probably benign Het
Tor4a A G 2: 25,195,792 V33A probably benign Het
Traj52 C T 14: 54,165,361 T15I Het
Trim50 G A 5: 135,363,914 V228M probably benign Het
Trpm1 A T 7: 64,208,909 I360F possibly damaging Het
Ubn1 T C 16: 5,077,105 S672P probably damaging Het
Ugt2a2 C T 5: 87,474,641 C156Y probably damaging Het
Wnk1 T C 6: 119,927,196 S2223G unknown Het
Wnt7b G T 15: 85,543,679 A194E probably damaging Het
Zmpste24 A G 4: 121,082,831 V206A probably benign Het
Other mutations in Trpm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Trpm6 APN 19 18783908 splice site probably benign
IGL00862:Trpm6 APN 19 18827528 missense probably damaging 1.00
IGL01348:Trpm6 APN 19 18877651 missense probably damaging 1.00
IGL01400:Trpm6 APN 19 18825794 nonsense probably null
IGL01451:Trpm6 APN 19 18809569 missense probably damaging 1.00
IGL01508:Trpm6 APN 19 18796530 nonsense probably null
IGL01995:Trpm6 APN 19 18830327 splice site probably benign
IGL02092:Trpm6 APN 19 18772331 missense possibly damaging 0.59
IGL02152:Trpm6 APN 19 18832539 missense possibly damaging 0.93
IGL02294:Trpm6 APN 19 18854063 missense probably benign
IGL02329:Trpm6 APN 19 18854217 missense probably benign 0.17
IGL02366:Trpm6 APN 19 18778510 splice site probably benign
IGL02402:Trpm6 APN 19 18786756 missense probably benign 0.18
IGL02457:Trpm6 APN 19 18825791 missense probably damaging 1.00
IGL02457:Trpm6 APN 19 18827398 nonsense probably null
IGL02684:Trpm6 APN 19 18802207 splice site probably benign
IGL02705:Trpm6 APN 19 18776733 critical splice donor site probably null
IGL02728:Trpm6 APN 19 18809652 missense possibly damaging 0.71
IGL02742:Trpm6 APN 19 18830012 splice site probably benign
IGL02818:Trpm6 APN 19 18866257 missense probably benign 0.04
IGL02836:Trpm6 APN 19 18813482 missense probably damaging 1.00
IGL03119:Trpm6 APN 19 18838017 nonsense probably null
IGL03193:Trpm6 APN 19 18825872 missense possibly damaging 0.94
IGL03227:Trpm6 APN 19 18819119 missense probably benign 0.01
IGL03227:Trpm6 APN 19 18786779 missense probably benign 0.12
IGL03231:Trpm6 APN 19 18819181 missense probably benign
IGL03245:Trpm6 APN 19 18877701 missense probably damaging 1.00
IGL03328:Trpm6 APN 19 18838082 missense possibly damaging 0.94
IGL03341:Trpm6 APN 19 18813486 missense probably benign
P0043:Trpm6 UTSW 19 18877765 missense probably damaging 1.00
PIT4260001:Trpm6 UTSW 19 18825802 missense possibly damaging 0.48
R0057:Trpm6 UTSW 19 18786755 missense probably benign 0.05
R0115:Trpm6 UTSW 19 18829952 missense probably damaging 0.98
R0119:Trpm6 UTSW 19 18832593 missense probably benign 0.05
R0140:Trpm6 UTSW 19 18819194 splice site probably null
R0267:Trpm6 UTSW 19 18823378 missense probably benign
R0350:Trpm6 UTSW 19 18883957 splice site probably null
R0373:Trpm6 UTSW 19 18853587 missense probably benign 0.15
R0393:Trpm6 UTSW 19 18778644 missense probably damaging 0.99
R0416:Trpm6 UTSW 19 18783025 splice site probably benign
R0505:Trpm6 UTSW 19 18873902 splice site probably benign
R0526:Trpm6 UTSW 19 18792876 missense probably damaging 0.97
R0607:Trpm6 UTSW 19 18872221 missense probably benign 0.00
R0609:Trpm6 UTSW 19 18825862 missense probably damaging 0.97
R0714:Trpm6 UTSW 19 18838087 missense possibly damaging 0.90
R1215:Trpm6 UTSW 19 18796498 missense probably damaging 1.00
R1474:Trpm6 UTSW 19 18796495 missense probably benign 0.28
R1512:Trpm6 UTSW 19 18875931 missense probably benign
R1558:Trpm6 UTSW 19 18786828 missense probably benign 0.04
R1597:Trpm6 UTSW 19 18827524 missense probably damaging 0.98
R1618:Trpm6 UTSW 19 18877631 missense possibly damaging 0.88
R1779:Trpm6 UTSW 19 18856217 missense probably damaging 1.00
R1796:Trpm6 UTSW 19 18827567 missense possibly damaging 0.90
R1799:Trpm6 UTSW 19 18891999 splice site probably null
R1840:Trpm6 UTSW 19 18866267 missense probably benign 0.21
R1991:Trpm6 UTSW 19 18796284 missense probably benign 0.00
R2030:Trpm6 UTSW 19 18854265 missense probably benign
R2073:Trpm6 UTSW 19 18876042 missense probably damaging 1.00
R2074:Trpm6 UTSW 19 18877739 missense probably damaging 1.00
R2096:Trpm6 UTSW 19 18825752 missense probably damaging 0.97
R2103:Trpm6 UTSW 19 18796284 missense probably benign 0.00
R2106:Trpm6 UTSW 19 18813350 missense possibly damaging 0.95
R2117:Trpm6 UTSW 19 18829952 missense probably damaging 0.98
R2850:Trpm6 UTSW 19 18792090 missense possibly damaging 0.68
R3125:Trpm6 UTSW 19 18854431 missense probably benign 0.05
R3719:Trpm6 UTSW 19 18772393 nonsense probably null
R3779:Trpm6 UTSW 19 18876039 missense possibly damaging 0.80
R4115:Trpm6 UTSW 19 18832557 missense probably damaging 1.00
R4367:Trpm6 UTSW 19 18827525 missense probably damaging 0.99
R4523:Trpm6 UTSW 19 18796500 missense probably damaging 1.00
R4546:Trpm6 UTSW 19 18832477 missense probably damaging 1.00
R4564:Trpm6 UTSW 19 18832597 missense possibly damaging 0.95
R4565:Trpm6 UTSW 19 18825872 missense probably damaging 1.00
R4697:Trpm6 UTSW 19 18853791 missense probably benign 0.01
R4714:Trpm6 UTSW 19 18854200 missense possibly damaging 0.93
R4750:Trpm6 UTSW 19 18876064 missense probably damaging 0.99
R4771:Trpm6 UTSW 19 18813493 missense probably damaging 0.97
R4791:Trpm6 UTSW 19 18867981 missense probably benign 0.00
R4814:Trpm6 UTSW 19 18862212 missense probably benign 0.11
R5028:Trpm6 UTSW 19 18786760 missense probably damaging 1.00
R5237:Trpm6 UTSW 19 18813464 missense probably damaging 1.00
R5615:Trpm6 UTSW 19 18829933 missense probably damaging 0.96
R5642:Trpm6 UTSW 19 18830207 missense probably damaging 1.00
R5645:Trpm6 UTSW 19 18853604 missense probably damaging 1.00
R5726:Trpm6 UTSW 19 18853617 missense probably damaging 1.00
R5832:Trpm6 UTSW 19 18786819 missense possibly damaging 0.66
R5843:Trpm6 UTSW 19 18856175 missense probably benign 0.04
R5955:Trpm6 UTSW 19 18892019 missense possibly damaging 0.75
R6101:Trpm6 UTSW 19 18853748 nonsense probably null
R6105:Trpm6 UTSW 19 18853748 nonsense probably null
R6211:Trpm6 UTSW 19 18783128 missense probably damaging 1.00
R6228:Trpm6 UTSW 19 18854291 missense probably damaging 1.00
R6263:Trpm6 UTSW 19 18854108 missense possibly damaging 0.94
R6453:Trpm6 UTSW 19 18829990 missense probably damaging 1.00
R6562:Trpm6 UTSW 19 18838042 missense probably damaging 1.00
R6624:Trpm6 UTSW 19 18796439 critical splice acceptor site probably null
R6624:Trpm6 UTSW 19 18889020 missense probably damaging 1.00
R6729:Trpm6 UTSW 19 18830297 missense probably damaging 1.00
R6765:Trpm6 UTSW 19 18877765 missense probably damaging 1.00
R6976:Trpm6 UTSW 19 18783163 missense probably benign
R7103:Trpm6 UTSW 19 18813547 missense possibly damaging 0.87
R7126:Trpm6 UTSW 19 18854033 nonsense probably null
R7128:Trpm6 UTSW 19 18811773 missense possibly damaging 0.92
R7157:Trpm6 UTSW 19 18838098 missense possibly damaging 0.91
R7212:Trpm6 UTSW 19 18853791 missense probably benign 0.01
R7263:Trpm6 UTSW 19 18876786 missense probably damaging 1.00
R7268:Trpm6 UTSW 19 18778585 missense probably benign 0.13
R7305:Trpm6 UTSW 19 18876091 missense probably benign 0.30
R7558:Trpm6 UTSW 19 18778665 missense probably damaging 0.96
R7590:Trpm6 UTSW 19 18832581 missense probably benign 0.31
R7646:Trpm6 UTSW 19 18867961 missense probably benign 0.10
R7650:Trpm6 UTSW 19 18876013 missense possibly damaging 0.70
R7727:Trpm6 UTSW 19 18854249 missense probably damaging 0.97
R7743:Trpm6 UTSW 19 18827408 missense probably benign 0.03
R7747:Trpm6 UTSW 19 18750045 splice site probably null
R7807:Trpm6 UTSW 19 18829856 missense probably benign 0.11
R7870:Trpm6 UTSW 19 18815241 missense probably benign 0.01
R7891:Trpm6 UTSW 19 18776710 missense probably benign 0.01
R7955:Trpm6 UTSW 19 18854290 missense probably benign 0.01
R7965:Trpm6 UTSW 19 18876110 missense probably damaging 1.00
R7967:Trpm6 UTSW 19 18778659 missense probably damaging 0.99
R7992:Trpm6 UTSW 19 18815350 missense probably damaging 1.00
R8035:Trpm6 UTSW 19 18792862 missense probably damaging 0.97
R8108:Trpm6 UTSW 19 18811790 missense probably damaging 1.00
R8268:Trpm6 UTSW 19 18873861 missense possibly damaging 0.85
R8411:Trpm6 UTSW 19 18853968 missense probably benign 0.39
R8413:Trpm6 UTSW 19 18832485 missense probably benign 0.00
R8534:Trpm6 UTSW 19 18892095 missense probably benign 0.00
R8932:Trpm6 UTSW 19 18838002 missense possibly damaging 0.87
R8990:Trpm6 UTSW 19 18815435 missense probably damaging 1.00
R9403:Trpm6 UTSW 19 18832652 missense possibly damaging 0.84
R9446:Trpm6 UTSW 19 18838098 missense possibly damaging 0.91
R9463:Trpm6 UTSW 19 18783900 critical splice donor site probably null
R9485:Trpm6 UTSW 19 18778614 missense probably benign 0.06
R9536:Trpm6 UTSW 19 18786759 missense probably damaging 1.00
R9549:Trpm6 UTSW 19 18876030 nonsense probably null
R9564:Trpm6 UTSW 19 18873876 missense possibly damaging 0.92
R9626:Trpm6 UTSW 19 18813482 missense probably damaging 1.00
R9655:Trpm6 UTSW 19 18892102 missense probably benign
R9721:Trpm6 UTSW 19 18829972 missense probably benign 0.12
R9742:Trpm6 UTSW 19 18823402 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TCAGGTGCTGTCACAAGAG -3'
(R):5'- TGCCAGGTTTCTAGACTGCC -3'

Sequencing Primer
(F):5'- GGAAATGGATGGGGGTCTCC -3'
(R):5'- TTCTACCACTCTACCCACAAAG -3'
Posted On 2019-10-17