Incidental Mutation 'R7472:Gba2'
ID581271
Institutional Source Beutler Lab
Gene Symbol Gba2
Ensembl Gene ENSMUSG00000028467
Gene Nameglucosidase beta 2
Synonymsbile acid
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7472 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location43566928-43578873 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43568967 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 563 (T563A)
Ref Sequence ENSEMBL: ENSMUSP00000030189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030189] [ENSMUST00000102944] [ENSMUST00000130443] [ENSMUST00000132631] [ENSMUST00000167751]
Predicted Effect probably benign
Transcript: ENSMUST00000030189
AA Change: T563A

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000030189
Gene: ENSMUSG00000028467
AA Change: T563A

DomainStartEndE-ValueType
Pfam:GBA2_N 142 446 9.4e-106 PFAM
Pfam:DUF608 512 879 1.3e-153 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102944
SMART Domains Protein: ENSMUSP00000100008
Gene: ENSMUSG00000028466

DomainStartEndE-ValueType
low complexity region 54 83 N/A INTRINSIC
low complexity region 132 147 N/A INTRINSIC
BRLZ 158 222 2.03e-15 SMART
low complexity region 240 253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130443
SMART Domains Protein: ENSMUSP00000119589
Gene: ENSMUSG00000028467

DomainStartEndE-ValueType
Pfam:GBA2_N 142 180 5.6e-13 PFAM
Pfam:GBA2_N 178 227 1.5e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132631
Predicted Effect probably benign
Transcript: ENSMUST00000167751
SMART Domains Protein: ENSMUSP00000129401
Gene: ENSMUSG00000028466

DomainStartEndE-ValueType
low complexity region 54 83 N/A INTRINSIC
low complexity region 156 171 N/A INTRINSIC
BRLZ 182 246 2.03e-15 SMART
low complexity region 264 277 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (99/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microsomal beta-glucosidase that catalyzes the hydrolysis of bile acid 3-O-glucosides as endogenous compounds. Studies to determine subcellular localization of this protein in the liver indicated that the enzyme was mainly enriched in the microsomal fraction where it appeared to be confined to the endoplasmic reticulum. This putative transmembrane protein is thought to play a role in carbohydrate transport and metabolism. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit accumulation of glucosylceramides in multiple tissues, and show impaired male fertility associated with globozoospermia, oligozoospermia, reduced sperm motility, and male germ cell apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik A G 2: 19,540,408 I78T probably benign Het
4921524J17Rik G A 8: 85,432,809 probably benign Het
4932415D10Rik T C 10: 82,283,587 I4530V probably benign Het
4932438H23Rik T C 16: 91,055,856 T131A probably benign Het
Acbd6 G T 1: 155,587,467 E138* probably null Het
Ago3 A G 4: 126,345,517 V847A probably damaging Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Als2cl C A 9: 110,898,106 H913Q probably benign Het
Atf6 A C 1: 170,815,491 S360R possibly damaging Het
Atm G C 9: 53,448,125 N2789K possibly damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Bpifa6 A T 2: 153,989,329 I272F possibly damaging Het
Cabin1 G T 10: 75,658,647 P1633T probably damaging Het
Camsap2 A G 1: 136,281,393 V119A probably damaging Het
Ccdc40 A G 11: 119,263,148 E1082G probably benign Het
Cchcr1 C A 17: 35,528,351 A479D probably damaging Het
Chpt1 C T 10: 88,476,368 V349I probably benign Het
Cldn13 A T 5: 134,915,121 I70K probably damaging Het
Col6a6 T A 9: 105,782,423 D441V probably damaging Het
Cpne5 G T 17: 29,204,740 T138K probably benign Het
Creb3l3 A T 10: 81,089,467 probably null Het
Cst10 C T 2: 149,405,576 L71F probably benign Het
Ctsb T C 14: 63,138,101 V172A probably benign Het
Cyp19a1 A G 9: 54,166,993 Y426H possibly damaging Het
Cyth4 T C 15: 78,605,894 F72S probably damaging Het
D430041D05Rik G T 2: 104,410,139 Q9K unknown Het
Dnah1 T A 14: 31,261,590 I4099F probably damaging Het
Dnah1 T A 14: 31,300,791 I1130F possibly damaging Het
Dnah12 A G 14: 26,856,635 K3117R probably benign Het
Dpf3 A T 12: 83,272,385 S275R probably benign Het
Dst A G 1: 34,218,497 N2450S probably benign Het
Dync1h1 C T 12: 110,665,675 R4460W probably damaging Het
Ecm1 A C 3: 95,735,320 C414G possibly damaging Het
Eef2 G A 10: 81,179,550 D302N probably benign Het
Egf T C 3: 129,686,263 D1038G possibly damaging Het
Epm2aip1 T C 9: 111,272,399 S147P probably damaging Het
Esam C A 9: 37,537,567 P324T possibly damaging Het
Fam160b1 A G 19: 57,368,585 Y36C probably damaging Het
Fbxo36 A G 1: 84,896,580 D99G probably damaging Het
Fhad1 G A 4: 141,964,626 R400C probably benign Het
Fndc3b T C 3: 27,461,744 T638A probably benign Het
Gm11237 G A 4: 73,624,499 G79S probably damaging Het
Gm156 A T 6: 129,775,382 F57I probably benign Het
Gm8180 T A 14: 43,783,637 N38I possibly damaging Het
Hs3st4 A G 7: 124,397,026 E305G probably damaging Het
Ireb2 T A 9: 54,884,054 F191I probably benign Het
Irx3 T G 8: 91,799,997 T360P probably benign Het
Itpr1 T A 6: 108,403,396 I1375N probably benign Het
Lama4 A T 10: 39,087,373 I1314F possibly damaging Het
Lamb2 C A 9: 108,486,148 A842D probably benign Het
Ldlrap1 A G 4: 134,758,996 Y51H possibly damaging Het
Leo1 A G 9: 75,448,341 D321G probably damaging Het
Lrrc14b A G 13: 74,363,107 S285P probably damaging Het
Macf1 A G 4: 123,433,067 V4881A probably benign Het
Mfsd2b A T 12: 4,866,481 F333I probably damaging Het
Micall1 T C 15: 79,122,560 S196P unknown Het
Mrps21 T C 3: 95,862,798 N73S probably benign Het
Msln C T 17: 25,750,734 V341M possibly damaging Het
Mybpc3 A T 2: 91,131,656 M840L probably damaging Het
Myo7a A C 7: 98,064,793 F1613V probably damaging Het
Naprt C T 15: 75,891,758 probably null Het
Nbr1 T C 11: 101,571,939 V572A probably damaging Het
Nfkbie A T 17: 45,559,307 T193S probably damaging Het
Nlrp14 T G 7: 107,190,044 N672K probably benign Het
Olfr1453 T C 19: 13,028,075 T85A probably benign Het
Olfr32 A G 2: 90,138,324 Y272H probably damaging Het
Olfr323 A T 11: 58,625,434 I204N probably damaging Het
Olfr427 A T 1: 174,099,733 I92F probably damaging Het
Olfr597 A G 7: 103,320,449 T13A Het
Olfr913 A T 9: 38,594,904 I228L probably benign Het
Oscar T C 7: 3,611,150 T197A possibly damaging Het
P3h3 C A 6: 124,850,631 A481S possibly damaging Het
Pcdh8 T C 14: 79,771,251 probably null Het
Pcsk9 A T 4: 106,458,897 H116Q probably benign Het
Ptcd1 A G 5: 145,154,730 F520L possibly damaging Het
Rapgef2 T C 3: 79,069,273 T1261A probably benign Het
Ribc2 T A 15: 85,135,245 M76K probably benign Het
Sin3b A G 8: 72,753,225 E853G probably damaging Het
Slit2 A G 5: 48,256,838 D940G probably damaging Het
Smarcb1 T A 10: 75,897,539 N342Y probably damaging Het
Smurf2 A T 11: 106,836,095 I469N probably damaging Het
Spta1 T C 1: 174,246,499 Y2335H probably damaging Het
Suz12 C T 11: 80,024,975 R425C probably benign Het
Synpo G A 18: 60,629,823 A4V probably benign Het
Tet1 A C 10: 62,813,350 S157A possibly damaging Het
Themis A G 10: 28,761,419 E173G possibly damaging Het
Timmdc1 A T 16: 38,505,418 L197* probably null Het
Tmem63c T C 12: 87,069,158 F191S possibly damaging Het
Tnn G A 1: 160,110,347 T1200I probably benign Het
Traf6 A G 2: 101,697,192 H429R probably benign Het
Trem3 T C 17: 48,249,845 S115P probably benign Het
Trip11 A T 12: 101,885,380 N808K probably benign Het
Trub2 A T 2: 29,783,373 V106E probably damaging Het
Ugcg A G 4: 59,217,156 I227V probably benign Het
Vat1l G A 8: 114,236,799 probably null Het
Vmn1r184 T C 7: 26,267,399 M190T possibly damaging Het
Vmn2r3 T C 3: 64,275,532 T249A probably benign Het
Zfp729b A C 13: 67,593,883 S88A probably benign Het
Zfp995 T C 17: 21,880,200 Y351C probably damaging Het
Other mutations in Gba2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Gba2 APN 4 43568477 missense probably damaging 1.00
IGL01577:Gba2 APN 4 43573753 nonsense probably null
IGL02066:Gba2 APN 4 43570175 missense probably benign 0.18
IGL02126:Gba2 APN 4 43567918 critical splice acceptor site probably null
IGL02243:Gba2 APN 4 43568719 missense probably benign 0.13
IGL02474:Gba2 APN 4 43568538 missense possibly damaging 0.69
IGL02567:Gba2 APN 4 43567281 missense probably benign
IGL02628:Gba2 APN 4 43568919 missense probably benign 0.01
IGL02706:Gba2 APN 4 43567257 missense probably benign 0.01
IGL02795:Gba2 APN 4 43578331 missense probably damaging 1.00
R0389:Gba2 UTSW 4 43570832 missense probably damaging 1.00
R0555:Gba2 UTSW 4 43569927 missense probably damaging 1.00
R0650:Gba2 UTSW 4 43570424 unclassified probably null
R1603:Gba2 UTSW 4 43567823 missense probably damaging 1.00
R1628:Gba2 UTSW 4 43570118 missense probably benign 0.00
R1664:Gba2 UTSW 4 43578080 missense probably benign 0.01
R1686:Gba2 UTSW 4 43573869 splice site probably benign
R1730:Gba2 UTSW 4 43578242 missense probably benign 0.01
R2036:Gba2 UTSW 4 43568118 unclassified probably benign
R2061:Gba2 UTSW 4 43574029 nonsense probably null
R2259:Gba2 UTSW 4 43570107 missense probably benign
R2847:Gba2 UTSW 4 43568000 unclassified probably null
R3026:Gba2 UTSW 4 43578308 missense possibly damaging 0.95
R3617:Gba2 UTSW 4 43573803 missense probably damaging 1.00
R4225:Gba2 UTSW 4 43569464 unclassified probably benign
R4346:Gba2 UTSW 4 43571337 missense probably benign 0.04
R4601:Gba2 UTSW 4 43573810 missense probably damaging 1.00
R4611:Gba2 UTSW 4 43568092 missense probably damaging 1.00
R4664:Gba2 UTSW 4 43568619 unclassified probably benign
R4784:Gba2 UTSW 4 43568315 missense probably damaging 1.00
R4785:Gba2 UTSW 4 43568315 missense probably damaging 1.00
R5079:Gba2 UTSW 4 43568640 unclassified probably benign
R5327:Gba2 UTSW 4 43574063 missense probably damaging 1.00
R5746:Gba2 UTSW 4 43568465 unclassified probably null
R6052:Gba2 UTSW 4 43568330 missense probably damaging 1.00
R6485:Gba2 UTSW 4 43574118 missense probably damaging 1.00
R7073:Gba2 UTSW 4 43573753 missense probably damaging 1.00
R7112:Gba2 UTSW 4 43568453 missense probably benign 0.01
RF007:Gba2 UTSW 4 43569894 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATATGCGTTGACCCGGAG -3'
(R):5'- GGGTAACGTCTCTGCTTTCC -3'

Sequencing Primer
(F):5'- GCCATGGCTCATCATCTGTTGG -3'
(R):5'- TGAGCTCTTATTGTCTCTCAGATAAC -3'
Posted On2019-10-17