Incidental Mutation 'R7472:Fhad1'
ID581278
Institutional Source Beutler Lab
Gene Symbol Fhad1
Ensembl Gene ENSMUSG00000051435
Gene Nameforkhead-associated (FHA) phosphopeptide binding domain 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R7472 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location141890438-142015082 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 141964626 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 400 (R400C)
Ref Sequence ENSEMBL: ENSMUSP00000101405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105779] [ENSMUST00000105780]
Predicted Effect probably benign
Transcript: ENSMUST00000105779
AA Change: R400C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101405
Gene: ENSMUSG00000051435
AA Change: R400C

DomainStartEndE-ValueType
FHA 17 69 8.41e-8 SMART
low complexity region 111 124 N/A INTRINSIC
coiled coil region 307 434 N/A INTRINSIC
coiled coil region 640 915 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
coiled coil region 1111 1140 N/A INTRINSIC
coiled coil region 1255 1339 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105780
AA Change: R400C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101406
Gene: ENSMUSG00000051435
AA Change: R400C

DomainStartEndE-ValueType
FHA 17 69 8.41e-8 SMART
low complexity region 111 124 N/A INTRINSIC
coiled coil region 307 434 N/A INTRINSIC
coiled coil region 640 915 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
coiled coil region 1111 1140 N/A INTRINSIC
coiled coil region 1255 1339 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (99/100)
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik A G 2: 19,540,408 I78T probably benign Het
4921524J17Rik G A 8: 85,432,809 probably benign Het
4932415D10Rik T C 10: 82,283,587 I4530V probably benign Het
4932438H23Rik T C 16: 91,055,856 T131A probably benign Het
Acbd6 G T 1: 155,587,467 E138* probably null Het
Ago3 A G 4: 126,345,517 V847A probably damaging Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Als2cl C A 9: 110,898,106 H913Q probably benign Het
Atf6 A C 1: 170,815,491 S360R possibly damaging Het
Atm G C 9: 53,448,125 N2789K possibly damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Bpifa6 A T 2: 153,989,329 I272F possibly damaging Het
Cabin1 G T 10: 75,658,647 P1633T probably damaging Het
Camsap2 A G 1: 136,281,393 V119A probably damaging Het
Ccdc40 A G 11: 119,263,148 E1082G probably benign Het
Cchcr1 C A 17: 35,528,351 A479D probably damaging Het
Chpt1 C T 10: 88,476,368 V349I probably benign Het
Cldn13 A T 5: 134,915,121 I70K probably damaging Het
Col6a6 T A 9: 105,782,423 D441V probably damaging Het
Cpne5 G T 17: 29,204,740 T138K probably benign Het
Creb3l3 A T 10: 81,089,467 probably null Het
Cst10 C T 2: 149,405,576 L71F probably benign Het
Ctsb T C 14: 63,138,101 V172A probably benign Het
Cyp19a1 A G 9: 54,166,993 Y426H possibly damaging Het
Cyth4 T C 15: 78,605,894 F72S probably damaging Het
D430041D05Rik G T 2: 104,410,139 Q9K unknown Het
Dnah1 T A 14: 31,261,590 I4099F probably damaging Het
Dnah1 T A 14: 31,300,791 I1130F possibly damaging Het
Dnah12 A G 14: 26,856,635 K3117R probably benign Het
Dpf3 A T 12: 83,272,385 S275R probably benign Het
Dst A G 1: 34,218,497 N2450S probably benign Het
Dync1h1 C T 12: 110,665,675 R4460W probably damaging Het
Ecm1 A C 3: 95,735,320 C414G possibly damaging Het
Eef2 G A 10: 81,179,550 D302N probably benign Het
Egf T C 3: 129,686,263 D1038G possibly damaging Het
Epm2aip1 T C 9: 111,272,399 S147P probably damaging Het
Esam C A 9: 37,537,567 P324T possibly damaging Het
Fam160b1 A G 19: 57,368,585 Y36C probably damaging Het
Fbxo36 A G 1: 84,896,580 D99G probably damaging Het
Fndc3b T C 3: 27,461,744 T638A probably benign Het
Gba2 T C 4: 43,568,967 T563A probably benign Het
Gm11237 G A 4: 73,624,499 G79S probably damaging Het
Gm156 A T 6: 129,775,382 F57I probably benign Het
Gm8180 T A 14: 43,783,637 N38I possibly damaging Het
Hs3st4 A G 7: 124,397,026 E305G probably damaging Het
Ireb2 T A 9: 54,884,054 F191I probably benign Het
Irx3 T G 8: 91,799,997 T360P probably benign Het
Itpr1 T A 6: 108,403,396 I1375N probably benign Het
Lama4 A T 10: 39,087,373 I1314F possibly damaging Het
Lamb2 C A 9: 108,486,148 A842D probably benign Het
Ldlrap1 A G 4: 134,758,996 Y51H possibly damaging Het
Leo1 A G 9: 75,448,341 D321G probably damaging Het
Lrrc14b A G 13: 74,363,107 S285P probably damaging Het
Macf1 A G 4: 123,433,067 V4881A probably benign Het
Mfsd2b A T 12: 4,866,481 F333I probably damaging Het
Micall1 T C 15: 79,122,560 S196P unknown Het
Mrps21 T C 3: 95,862,798 N73S probably benign Het
Msln C T 17: 25,750,734 V341M possibly damaging Het
Mybpc3 A T 2: 91,131,656 M840L probably damaging Het
Myo7a A C 7: 98,064,793 F1613V probably damaging Het
Naprt C T 15: 75,891,758 probably null Het
Nbr1 T C 11: 101,571,939 V572A probably damaging Het
Nfkbie A T 17: 45,559,307 T193S probably damaging Het
Nlrp14 T G 7: 107,190,044 N672K probably benign Het
Olfr1453 T C 19: 13,028,075 T85A probably benign Het
Olfr32 A G 2: 90,138,324 Y272H probably damaging Het
Olfr323 A T 11: 58,625,434 I204N probably damaging Het
Olfr427 A T 1: 174,099,733 I92F probably damaging Het
Olfr597 A G 7: 103,320,449 T13A Het
Olfr913 A T 9: 38,594,904 I228L probably benign Het
Oscar T C 7: 3,611,150 T197A possibly damaging Het
P3h3 C A 6: 124,850,631 A481S possibly damaging Het
Pcdh8 T C 14: 79,771,251 probably null Het
Pcsk9 A T 4: 106,458,897 H116Q probably benign Het
Ptcd1 A G 5: 145,154,730 F520L possibly damaging Het
Rapgef2 T C 3: 79,069,273 T1261A probably benign Het
Ribc2 T A 15: 85,135,245 M76K probably benign Het
Sin3b A G 8: 72,753,225 E853G probably damaging Het
Slit2 A G 5: 48,256,838 D940G probably damaging Het
Smarcb1 T A 10: 75,897,539 N342Y probably damaging Het
Smurf2 A T 11: 106,836,095 I469N probably damaging Het
Spta1 T C 1: 174,246,499 Y2335H probably damaging Het
Suz12 C T 11: 80,024,975 R425C probably benign Het
Synpo G A 18: 60,629,823 A4V probably benign Het
Tet1 A C 10: 62,813,350 S157A possibly damaging Het
Themis A G 10: 28,761,419 E173G possibly damaging Het
Timmdc1 A T 16: 38,505,418 L197* probably null Het
Tmem63c T C 12: 87,069,158 F191S possibly damaging Het
Tnn G A 1: 160,110,347 T1200I probably benign Het
Traf6 A G 2: 101,697,192 H429R probably benign Het
Trem3 T C 17: 48,249,845 S115P probably benign Het
Trip11 A T 12: 101,885,380 N808K probably benign Het
Trub2 A T 2: 29,783,373 V106E probably damaging Het
Ugcg A G 4: 59,217,156 I227V probably benign Het
Vat1l G A 8: 114,236,799 probably null Het
Vmn1r184 T C 7: 26,267,399 M190T possibly damaging Het
Vmn2r3 T C 3: 64,275,532 T249A probably benign Het
Zfp729b A C 13: 67,593,883 S88A probably benign Het
Zfp995 T C 17: 21,880,200 Y351C probably damaging Het
Other mutations in Fhad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Fhad1 APN 4 141905612 missense probably benign 0.02
IGL01478:Fhad1 APN 4 141951638 missense possibly damaging 0.84
IGL01752:Fhad1 APN 4 141972899 missense possibly damaging 0.82
IGL01788:Fhad1 APN 4 141932802 missense probably benign 0.00
IGL01919:Fhad1 APN 4 141964595 missense probably damaging 0.96
IGL02489:Fhad1 APN 4 141957620 missense probably damaging 0.97
IGL02568:Fhad1 APN 4 141932794 missense probably null 1.00
IGL02583:Fhad1 APN 4 142011644 utr 5 prime probably benign
IGL02716:Fhad1 APN 4 141918331 missense possibly damaging 0.89
IGL02819:Fhad1 APN 4 141918758 missense probably benign 0.23
IGL02820:Fhad1 APN 4 141918758 missense probably benign 0.23
IGL03038:Fhad1 APN 4 142002494 missense probably benign 0.38
IGL03167:Fhad1 APN 4 141972797 missense probably benign 0.00
IGL03255:Fhad1 APN 4 141972880 missense possibly damaging 0.79
BB002:Fhad1 UTSW 4 141954187 missense probably damaging 0.97
BB012:Fhad1 UTSW 4 141954187 missense probably damaging 0.97
PIT1430001:Fhad1 UTSW 4 141909749 missense probably damaging 0.99
R0014:Fhad1 UTSW 4 141928408 missense probably damaging 1.00
R0116:Fhad1 UTSW 4 141940095 missense probably benign 0.06
R0143:Fhad1 UTSW 4 141929646 splice site probably benign
R0178:Fhad1 UTSW 4 141955340 missense probably benign 0.31
R0308:Fhad1 UTSW 4 141985593 splice site probably benign
R0384:Fhad1 UTSW 4 142002426 missense probably benign
R0583:Fhad1 UTSW 4 141903990 missense probably benign 0.37
R1501:Fhad1 UTSW 4 141964625 missense probably benign
R1584:Fhad1 UTSW 4 141985511 missense probably benign 0.22
R1615:Fhad1 UTSW 4 141922323 missense probably damaging 0.99
R1991:Fhad1 UTSW 4 141982162 missense possibly damaging 0.75
R2060:Fhad1 UTSW 4 141899249 missense probably benign 0.08
R2079:Fhad1 UTSW 4 141991202 nonsense probably null
R2133:Fhad1 UTSW 4 141928400 missense probably damaging 1.00
R2337:Fhad1 UTSW 4 141922344 missense possibly damaging 0.84
R2843:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2844:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2845:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2846:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2866:Fhad1 UTSW 4 141920788 missense probably benign 0.00
R3119:Fhad1 UTSW 4 141918307 frame shift probably null
R3760:Fhad1 UTSW 4 141909813 missense probably damaging 1.00
R4180:Fhad1 UTSW 4 141985543 missense possibly damaging 0.69
R4466:Fhad1 UTSW 4 141957658 missense probably damaging 1.00
R4627:Fhad1 UTSW 4 141896468 missense possibly damaging 0.47
R4680:Fhad1 UTSW 4 142011547 nonsense probably null
R4725:Fhad1 UTSW 4 141928378 critical splice donor site probably null
R4755:Fhad1 UTSW 4 141928483 missense probably damaging 1.00
R4831:Fhad1 UTSW 4 141916067 splice site probably null
R4909:Fhad1 UTSW 4 141985511 missense probably benign 0.01
R4968:Fhad1 UTSW 4 141918307 missense probably damaging 1.00
R5004:Fhad1 UTSW 4 142002599 critical splice acceptor site probably null
R5036:Fhad1 UTSW 4 141920741 missense probably benign 0.03
R5048:Fhad1 UTSW 4 141964676 critical splice acceptor site probably null
R5416:Fhad1 UTSW 4 141918802 missense probably benign 0.39
R5504:Fhad1 UTSW 4 141985535 missense probably benign
R5586:Fhad1 UTSW 4 141905131 missense probably benign 0.44
R5692:Fhad1 UTSW 4 141963457 missense probably benign 0.00
R5706:Fhad1 UTSW 4 141954116 missense probably damaging 1.00
R5773:Fhad1 UTSW 4 141929570 missense probably damaging 0.99
R5823:Fhad1 UTSW 4 141955306 missense possibly damaging 0.84
R5833:Fhad1 UTSW 4 142002527 missense probably damaging 1.00
R6170:Fhad1 UTSW 4 141890952 nonsense probably null
R6286:Fhad1 UTSW 4 141920898 missense probably damaging 1.00
R6610:Fhad1 UTSW 4 141916396 missense possibly damaging 0.94
R6755:Fhad1 UTSW 4 141964604 missense probably damaging 1.00
R7006:Fhad1 UTSW 4 141918291 frame shift probably null
R7008:Fhad1 UTSW 4 141918291 frame shift probably null
R7012:Fhad1 UTSW 4 141918291 frame shift probably null
R7014:Fhad1 UTSW 4 141918291 frame shift probably null
R7058:Fhad1 UTSW 4 141918291 frame shift probably null
R7059:Fhad1 UTSW 4 141918291 frame shift probably null
R7060:Fhad1 UTSW 4 141918291 frame shift probably null
R7159:Fhad1 UTSW 4 141951616 missense probably benign 0.01
R7670:Fhad1 UTSW 4 141951491 missense probably benign 0.01
R7694:Fhad1 UTSW 4 141905064 missense probably benign 0.41
R7745:Fhad1 UTSW 4 141890939 missense probably benign 0.00
R7848:Fhad1 UTSW 4 141905602 missense probably benign 0.29
R7853:Fhad1 UTSW 4 141909823 missense probably damaging 0.99
R7867:Fhad1 UTSW 4 141905591 missense probably benign 0.00
R7925:Fhad1 UTSW 4 141954187 missense probably damaging 0.97
R8089:Fhad1 UTSW 4 141957660 missense probably damaging 1.00
R8123:Fhad1 UTSW 4 141985525 missense probably benign 0.02
X0018:Fhad1 UTSW 4 141951616 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGACATTGTCCCTGCTCAGC -3'
(R):5'- TCTGTGTGCCTGTCAGACAC -3'

Sequencing Primer
(F):5'- TGCTCAGCTCCAGGGGAAAC -3'
(R):5'- TGTCACCCCTGCTGGAATGTG -3'
Posted On2019-10-17