Incidental Mutation 'R7472:Col6a6'
ID581303
Institutional Source Beutler Lab
Gene Symbol Col6a6
Ensembl Gene ENSMUSG00000043719
Gene Namecollagen, type VI, alpha 6
SynonymsE330026B02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R7472 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location105687809-105828160 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105782423 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 441 (D441V)
Ref Sequence ENSEMBL: ENSMUSP00000060840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060896] [ENSMUST00000098441] [ENSMUST00000166431]
Predicted Effect probably damaging
Transcript: ENSMUST00000060896
AA Change: D441V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060840
Gene: ENSMUSG00000043719
AA Change: D441V

DomainStartEndE-ValueType
VWA 24 197 4.26e-26 SMART
VWA 226 407 1.06e-30 SMART
VWA 433 610 5.19e-39 SMART
VWA 619 795 3.58e-42 SMART
VWA 806 982 6.64e-37 SMART
VWA 997 1175 2.7e-37 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000098441
AA Change: D441V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096040
Gene: ENSMUSG00000043719
AA Change: D441V

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
VWA 24 197 4.26e-26 SMART
VWA 226 407 1.06e-30 SMART
VWA 433 610 5.19e-39 SMART
VWA 619 795 3.58e-42 SMART
VWA 806 982 6.64e-37 SMART
VWA 997 1175 2.7e-37 SMART
VWA 1184 1370 3.45e-1 SMART
Pfam:Collagen 1389 1450 3.3e-9 PFAM
low complexity region 1451 1475 N/A INTRINSIC
low complexity region 1490 1508 N/A INTRINSIC
low complexity region 1602 1623 N/A INTRINSIC
low complexity region 1698 1724 N/A INTRINSIC
VWA 1754 1937 1.73e-17 SMART
VWA 1962 2145 4.4e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166431
AA Change: D441V

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125765
Gene: ENSMUSG00000043719
AA Change: D441V

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
VWA 24 197 4.26e-26 SMART
VWA 226 407 1.06e-30 SMART
VWA 433 610 5.19e-39 SMART
VWA 619 795 3.58e-42 SMART
VWA 806 982 6.64e-37 SMART
VWA 997 1175 2.7e-37 SMART
VWA 1184 1370 3.45e-1 SMART
Pfam:Collagen 1389 1450 9.3e-10 PFAM
low complexity region 1451 1475 N/A INTRINSIC
low complexity region 1490 1508 N/A INTRINSIC
low complexity region 1602 1623 N/A INTRINSIC
low complexity region 1698 1724 N/A INTRINSIC
VWA 1754 1937 1.73e-17 SMART
VWA 1962 2145 4.4e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (99/100)
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik A G 2: 19,540,408 I78T probably benign Het
4921524J17Rik G A 8: 85,432,809 probably benign Het
4932415D10Rik T C 10: 82,283,587 I4530V probably benign Het
4932438H23Rik T C 16: 91,055,856 T131A probably benign Het
Acbd6 G T 1: 155,587,467 E138* probably null Het
Ago3 A G 4: 126,345,517 V847A probably damaging Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Als2cl C A 9: 110,898,106 H913Q probably benign Het
Atf6 A C 1: 170,815,491 S360R possibly damaging Het
Atm G C 9: 53,448,125 N2789K possibly damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Bpifa6 A T 2: 153,989,329 I272F possibly damaging Het
Cabin1 G T 10: 75,658,647 P1633T probably damaging Het
Camsap2 A G 1: 136,281,393 V119A probably damaging Het
Ccdc40 A G 11: 119,263,148 E1082G probably benign Het
Cchcr1 C A 17: 35,528,351 A479D probably damaging Het
Chpt1 C T 10: 88,476,368 V349I probably benign Het
Cldn13 A T 5: 134,915,121 I70K probably damaging Het
Cpne5 G T 17: 29,204,740 T138K probably benign Het
Creb3l3 A T 10: 81,089,467 probably null Het
Cst10 C T 2: 149,405,576 L71F probably benign Het
Ctsb T C 14: 63,138,101 V172A probably benign Het
Cyp19a1 A G 9: 54,166,993 Y426H possibly damaging Het
Cyth4 T C 15: 78,605,894 F72S probably damaging Het
D430041D05Rik G T 2: 104,410,139 Q9K unknown Het
Dnah1 T A 14: 31,261,590 I4099F probably damaging Het
Dnah1 T A 14: 31,300,791 I1130F possibly damaging Het
Dnah12 A G 14: 26,856,635 K3117R probably benign Het
Dpf3 A T 12: 83,272,385 S275R probably benign Het
Dst A G 1: 34,218,497 N2450S probably benign Het
Dync1h1 C T 12: 110,665,675 R4460W probably damaging Het
Ecm1 A C 3: 95,735,320 C414G possibly damaging Het
Eef2 G A 10: 81,179,550 D302N probably benign Het
Egf T C 3: 129,686,263 D1038G possibly damaging Het
Epm2aip1 T C 9: 111,272,399 S147P probably damaging Het
Esam C A 9: 37,537,567 P324T possibly damaging Het
Fam160b1 A G 19: 57,368,585 Y36C probably damaging Het
Fbxo36 A G 1: 84,896,580 D99G probably damaging Het
Fhad1 G A 4: 141,964,626 R400C probably benign Het
Fndc3b T C 3: 27,461,744 T638A probably benign Het
Gba2 T C 4: 43,568,967 T563A probably benign Het
Gm11237 G A 4: 73,624,499 G79S probably damaging Het
Gm156 A T 6: 129,775,382 F57I probably benign Het
Gm8180 T A 14: 43,783,637 N38I possibly damaging Het
Hs3st4 A G 7: 124,397,026 E305G probably damaging Het
Ireb2 T A 9: 54,884,054 F191I probably benign Het
Irx3 T G 8: 91,799,997 T360P probably benign Het
Itpr1 T A 6: 108,403,396 I1375N probably benign Het
Lama4 A T 10: 39,087,373 I1314F possibly damaging Het
Lamb2 C A 9: 108,486,148 A842D probably benign Het
Ldlrap1 A G 4: 134,758,996 Y51H possibly damaging Het
Leo1 A G 9: 75,448,341 D321G probably damaging Het
Lrrc14b A G 13: 74,363,107 S285P probably damaging Het
Macf1 A G 4: 123,433,067 V4881A probably benign Het
Mfsd2b A T 12: 4,866,481 F333I probably damaging Het
Micall1 T C 15: 79,122,560 S196P unknown Het
Mrps21 T C 3: 95,862,798 N73S probably benign Het
Msln C T 17: 25,750,734 V341M possibly damaging Het
Mybpc3 A T 2: 91,131,656 M840L probably damaging Het
Myo7a A C 7: 98,064,793 F1613V probably damaging Het
Naprt C T 15: 75,891,758 probably null Het
Nbr1 T C 11: 101,571,939 V572A probably damaging Het
Nfkbie A T 17: 45,559,307 T193S probably damaging Het
Nlrp14 T G 7: 107,190,044 N672K probably benign Het
Olfr1453 T C 19: 13,028,075 T85A probably benign Het
Olfr32 A G 2: 90,138,324 Y272H probably damaging Het
Olfr323 A T 11: 58,625,434 I204N probably damaging Het
Olfr427 A T 1: 174,099,733 I92F probably damaging Het
Olfr597 A G 7: 103,320,449 T13A Het
Olfr913 A T 9: 38,594,904 I228L probably benign Het
Oscar T C 7: 3,611,150 T197A possibly damaging Het
P3h3 C A 6: 124,850,631 A481S possibly damaging Het
Pcdh8 T C 14: 79,771,251 probably null Het
Pcsk9 A T 4: 106,458,897 H116Q probably benign Het
Ptcd1 A G 5: 145,154,730 F520L possibly damaging Het
Rapgef2 T C 3: 79,069,273 T1261A probably benign Het
Ribc2 T A 15: 85,135,245 M76K probably benign Het
Sin3b A G 8: 72,753,225 E853G probably damaging Het
Slit2 A G 5: 48,256,838 D940G probably damaging Het
Smarcb1 T A 10: 75,897,539 N342Y probably damaging Het
Smurf2 A T 11: 106,836,095 I469N probably damaging Het
Spta1 T C 1: 174,246,499 Y2335H probably damaging Het
Suz12 C T 11: 80,024,975 R425C probably benign Het
Synpo G A 18: 60,629,823 A4V probably benign Het
Tet1 A C 10: 62,813,350 S157A possibly damaging Het
Themis A G 10: 28,761,419 E173G possibly damaging Het
Timmdc1 A T 16: 38,505,418 L197* probably null Het
Tmem63c T C 12: 87,069,158 F191S possibly damaging Het
Tnn G A 1: 160,110,347 T1200I probably benign Het
Traf6 A G 2: 101,697,192 H429R probably benign Het
Trem3 T C 17: 48,249,845 S115P probably benign Het
Trip11 A T 12: 101,885,380 N808K probably benign Het
Trub2 A T 2: 29,783,373 V106E probably damaging Het
Ugcg A G 4: 59,217,156 I227V probably benign Het
Vat1l G A 8: 114,236,799 probably null Het
Vmn1r184 T C 7: 26,267,399 M190T possibly damaging Het
Vmn2r3 T C 3: 64,275,532 T249A probably benign Het
Zfp729b A C 13: 67,593,883 S88A probably benign Het
Zfp995 T C 17: 21,880,200 Y351C probably damaging Het
Other mutations in Col6a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Col6a6 APN 9 105758191 critical splice acceptor site probably null
IGL00768:Col6a6 APN 9 105782412 missense probably benign 0.04
IGL00917:Col6a6 APN 9 105784254 splice site probably benign
IGL01385:Col6a6 APN 9 105783666 missense probably damaging 1.00
IGL01411:Col6a6 APN 9 105785958 nonsense probably null
IGL01508:Col6a6 APN 9 105727166 splice site probably benign
IGL01668:Col6a6 APN 9 105709271 missense probably damaging 1.00
IGL01733:Col6a6 APN 9 105709255 missense possibly damaging 0.92
IGL01932:Col6a6 APN 9 105689626 missense probably benign 0.02
IGL01934:Col6a6 APN 9 105698659 critical splice donor site probably null
IGL01944:Col6a6 APN 9 105783909 missense probably damaging 1.00
IGL01980:Col6a6 APN 9 105780985 missense probably damaging 0.96
IGL02114:Col6a6 APN 9 105767199 critical splice donor site probably null
IGL02129:Col6a6 APN 9 105736340 splice site probably benign
IGL02201:Col6a6 APN 9 105780995 missense probably damaging 1.00
IGL02335:Col6a6 APN 9 105784101 missense probably damaging 1.00
IGL02541:Col6a6 APN 9 105732216 missense probably benign 0.05
IGL02574:Col6a6 APN 9 105782191 missense probably damaging 1.00
IGL02649:Col6a6 APN 9 105727170 critical splice donor site probably null
IGL02852:Col6a6 APN 9 105784073 missense probably damaging 0.99
IGL03278:Col6a6 APN 9 105709452 missense probably benign 0.01
IGL03327:Col6a6 APN 9 105767234 missense possibly damaging 0.90
PIT4519001:Col6a6 UTSW 9 105732263 missense probably benign 0.23
R0042:Col6a6 UTSW 9 105780697 missense possibly damaging 0.89
R0046:Col6a6 UTSW 9 105748848 splice site probably benign
R0066:Col6a6 UTSW 9 105702213 missense probably damaging 0.99
R0066:Col6a6 UTSW 9 105702213 missense probably damaging 0.99
R0140:Col6a6 UTSW 9 105702275 missense probably damaging 1.00
R0278:Col6a6 UTSW 9 105767288 missense possibly damaging 0.87
R0281:Col6a6 UTSW 9 105784116 missense probably benign 0.13
R0382:Col6a6 UTSW 9 105755555 missense probably damaging 0.98
R0389:Col6a6 UTSW 9 105784204 missense probably benign 0.02
R0421:Col6a6 UTSW 9 105784206 missense probably benign 0.02
R0502:Col6a6 UTSW 9 105767351 missense probably benign 0.04
R0503:Col6a6 UTSW 9 105767351 missense probably benign 0.04
R0600:Col6a6 UTSW 9 105761440 missense probably damaging 1.00
R0626:Col6a6 UTSW 9 105777744 missense probably benign 0.45
R0629:Col6a6 UTSW 9 105727165 splice site probably benign
R0690:Col6a6 UTSW 9 105709486 missense probably benign 0.01
R1155:Col6a6 UTSW 9 105782090 missense possibly damaging 0.64
R1245:Col6a6 UTSW 9 105748910 missense possibly damaging 0.62
R1253:Col6a6 UTSW 9 105774303 missense probably null 0.98
R1263:Col6a6 UTSW 9 105709489 missense probably benign 0.01
R1296:Col6a6 UTSW 9 105781091 missense probably damaging 1.00
R1556:Col6a6 UTSW 9 105709473 missense possibly damaging 0.82
R1600:Col6a6 UTSW 9 105778075 missense probably damaging 1.00
R1612:Col6a6 UTSW 9 105777549 missense probably damaging 1.00
R1613:Col6a6 UTSW 9 105732211 critical splice donor site probably null
R1830:Col6a6 UTSW 9 105702270 missense probably damaging 0.99
R1858:Col6a6 UTSW 9 105781102 missense probably damaging 1.00
R1897:Col6a6 UTSW 9 105785744 missense possibly damaging 0.74
R1944:Col6a6 UTSW 9 105709384 missense probably damaging 1.00
R2366:Col6a6 UTSW 9 105755694 missense probably damaging 1.00
R2484:Col6a6 UTSW 9 105780804 missense probably damaging 0.98
R3079:Col6a6 UTSW 9 105754223 missense probably benign 0.01
R3176:Col6a6 UTSW 9 105786230 missense probably benign 0.01
R3276:Col6a6 UTSW 9 105786230 missense probably benign 0.01
R3429:Col6a6 UTSW 9 105777967 missense probably damaging 1.00
R3716:Col6a6 UTSW 9 105782174 missense probably damaging 0.98
R3809:Col6a6 UTSW 9 105780692 missense probably damaging 1.00
R3978:Col6a6 UTSW 9 105698879 missense probably damaging 0.98
R4087:Col6a6 UTSW 9 105783956 missense possibly damaging 0.68
R4382:Col6a6 UTSW 9 105783690 missense probably damaging 1.00
R4516:Col6a6 UTSW 9 105698949 missense possibly damaging 0.64
R4666:Col6a6 UTSW 9 105767342 missense possibly damaging 0.93
R4905:Col6a6 UTSW 9 105767424 missense probably damaging 1.00
R4923:Col6a6 UTSW 9 105788948 missense probably damaging 1.00
R4951:Col6a6 UTSW 9 105767198 critical splice donor site probably null
R5002:Col6a6 UTSW 9 105786093 missense probably benign 0.00
R5111:Col6a6 UTSW 9 105709474 missense possibly damaging 0.70
R5205:Col6a6 UTSW 9 105782033 missense probably damaging 0.99
R5399:Col6a6 UTSW 9 105709107 missense possibly damaging 0.50
R5475:Col6a6 UTSW 9 105774338 missense probably null 0.79
R5491:Col6a6 UTSW 9 105738236 missense probably damaging 0.98
R5758:Col6a6 UTSW 9 105761518 critical splice acceptor site probably null
R5934:Col6a6 UTSW 9 105767075 missense probably damaging 1.00
R6059:Col6a6 UTSW 9 105783917 missense probably damaging 1.00
R6284:Col6a6 UTSW 9 105727227 splice site probably null
R6425:Col6a6 UTSW 9 105698865 missense probably benign 0.21
R6464:Col6a6 UTSW 9 105788953 start codon destroyed probably null 0.60
R6469:Col6a6 UTSW 9 105698691 missense probably damaging 0.97
R6520:Col6a6 UTSW 9 105785825 missense possibly damaging 0.89
R6552:Col6a6 UTSW 9 105698913 missense probably damaging 1.00
R6750:Col6a6 UTSW 9 105783680 missense probably damaging 1.00
R6813:Col6a6 UTSW 9 105783941 missense probably benign 0.32
R7032:Col6a6 UTSW 9 105767508 missense probably damaging 0.96
R7260:Col6a6 UTSW 9 105783969 missense probably benign 0.00
R7541:Col6a6 UTSW 9 105767324 missense probably damaging 1.00
R7640:Col6a6 UTSW 9 105785744 missense possibly damaging 0.74
R7645:Col6a6 UTSW 9 105767198 critical splice donor site probably null
R7716:Col6a6 UTSW 9 105783903 missense possibly damaging 0.84
R7866:Col6a6 UTSW 9 105689561 missense probably damaging 0.96
R7949:Col6a6 UTSW 9 105689561 missense probably damaging 0.96
R8016:Col6a6 UTSW 9 105767528 missense possibly damaging 0.73
R8043:Col6a6 UTSW 9 105699020 missense probably damaging 0.98
R8073:Col6a6 UTSW 9 105781947 missense probably benign 0.01
R8082:Col6a6 UTSW 9 105783930 nonsense probably null
R8243:Col6a6 UTSW 9 105699269 missense probably damaging 1.00
R8306:Col6a6 UTSW 9 105784073 missense probably damaging 0.96
X0022:Col6a6 UTSW 9 105699332 missense probably damaging 1.00
Z1176:Col6a6 UTSW 9 105780952 missense probably damaging 1.00
Z1177:Col6a6 UTSW 9 105728255 missense probably damaging 1.00
Z1177:Col6a6 UTSW 9 105788895 missense probably null 0.24
Predicted Primers PCR Primer
(F):5'- GTGTGAAGTTCAAAGCCGCC -3'
(R):5'- AAGTCTTTGATGCTGGGAAGTTAC -3'

Sequencing Primer
(F):5'- ATGGCCTTTCCCAAGTCAGG -3'
(R):5'- AAGTTACTTCCATCTTCCTTCTGTAG -3'
Posted On2019-10-17