Incidental Mutation 'R7472:Dnah12'
ID581327
Institutional Source Beutler Lab
Gene Symbol Dnah12
Ensembl Gene ENSMUSG00000021879
Gene Namedynein, axonemal, heavy chain 12
SynonymsDHC3, Hdhc3, HL-19, Dnahc7l, 4921531P07Rik, LOC380889, DLP12, HL19, Dnahc12
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.205) question?
Stock #R7472 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location26693274-26891703 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26856635 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 3117 (K3117R)
Ref Sequence ENSEMBL: ENSMUSP00000022433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022433]
Predicted Effect probably benign
Transcript: ENSMUST00000022433
AA Change: K3117R

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000022433
Gene: ENSMUSG00000021879
AA Change: K3117R

DomainStartEndE-ValueType
low complexity region 127 140 N/A INTRINSIC
coiled coil region 588 666 N/A INTRINSIC
Pfam:DHC_N2 676 1113 1.1e-147 PFAM
AAA 1268 1407 1.15e0 SMART
Pfam:AAA_5 1552 1695 1.5e-7 PFAM
Blast:AAA 1709 1827 2e-24 BLAST
Blast:AAA 1848 1898 1e-16 BLAST
AAA 1903 2051 5.42e-4 SMART
Pfam:AAA_8 2238 2316 2e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (99/100)
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik A G 2: 19,540,408 I78T probably benign Het
4921524J17Rik G A 8: 85,432,809 probably benign Het
4932415D10Rik T C 10: 82,283,587 I4530V probably benign Het
4932438H23Rik T C 16: 91,055,856 T131A probably benign Het
Acbd6 G T 1: 155,587,467 E138* probably null Het
Ago3 A G 4: 126,345,517 V847A probably damaging Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Als2cl C A 9: 110,898,106 H913Q probably benign Het
Atf6 A C 1: 170,815,491 S360R possibly damaging Het
Atm G C 9: 53,448,125 N2789K possibly damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Bpifa6 A T 2: 153,989,329 I272F possibly damaging Het
Cabin1 G T 10: 75,658,647 P1633T probably damaging Het
Camsap2 A G 1: 136,281,393 V119A probably damaging Het
Ccdc40 A G 11: 119,263,148 E1082G probably benign Het
Cchcr1 C A 17: 35,528,351 A479D probably damaging Het
Chpt1 C T 10: 88,476,368 V349I probably benign Het
Cldn13 A T 5: 134,915,121 I70K probably damaging Het
Col6a6 T A 9: 105,782,423 D441V probably damaging Het
Cpne5 G T 17: 29,204,740 T138K probably benign Het
Creb3l3 A T 10: 81,089,467 probably null Het
Cst10 C T 2: 149,405,576 L71F probably benign Het
Ctsb T C 14: 63,138,101 V172A probably benign Het
Cyp19a1 A G 9: 54,166,993 Y426H possibly damaging Het
Cyth4 T C 15: 78,605,894 F72S probably damaging Het
D430041D05Rik G T 2: 104,410,139 Q9K unknown Het
Dnah1 T A 14: 31,261,590 I4099F probably damaging Het
Dnah1 T A 14: 31,300,791 I1130F possibly damaging Het
Dpf3 A T 12: 83,272,385 S275R probably benign Het
Dst A G 1: 34,218,497 N2450S probably benign Het
Dync1h1 C T 12: 110,665,675 R4460W probably damaging Het
Ecm1 A C 3: 95,735,320 C414G possibly damaging Het
Eef2 G A 10: 81,179,550 D302N probably benign Het
Egf T C 3: 129,686,263 D1038G possibly damaging Het
Epm2aip1 T C 9: 111,272,399 S147P probably damaging Het
Esam C A 9: 37,537,567 P324T possibly damaging Het
Fam160b1 A G 19: 57,368,585 Y36C probably damaging Het
Fbxo36 A G 1: 84,896,580 D99G probably damaging Het
Fhad1 G A 4: 141,964,626 R400C probably benign Het
Fndc3b T C 3: 27,461,744 T638A probably benign Het
Gba2 T C 4: 43,568,967 T563A probably benign Het
Gm11237 G A 4: 73,624,499 G79S probably damaging Het
Gm156 A T 6: 129,775,382 F57I probably benign Het
Gm8180 T A 14: 43,783,637 N38I possibly damaging Het
Hs3st4 A G 7: 124,397,026 E305G probably damaging Het
Ireb2 T A 9: 54,884,054 F191I probably benign Het
Irx3 T G 8: 91,799,997 T360P probably benign Het
Itpr1 T A 6: 108,403,396 I1375N probably benign Het
Lama4 A T 10: 39,087,373 I1314F possibly damaging Het
Lamb2 C A 9: 108,486,148 A842D probably benign Het
Ldlrap1 A G 4: 134,758,996 Y51H possibly damaging Het
Leo1 A G 9: 75,448,341 D321G probably damaging Het
Lrrc14b A G 13: 74,363,107 S285P probably damaging Het
Macf1 A G 4: 123,433,067 V4881A probably benign Het
Mfsd2b A T 12: 4,866,481 F333I probably damaging Het
Micall1 T C 15: 79,122,560 S196P unknown Het
Mrps21 T C 3: 95,862,798 N73S probably benign Het
Msln C T 17: 25,750,734 V341M possibly damaging Het
Mybpc3 A T 2: 91,131,656 M840L probably damaging Het
Myo7a A C 7: 98,064,793 F1613V probably damaging Het
Naprt C T 15: 75,891,758 probably null Het
Nbr1 T C 11: 101,571,939 V572A probably damaging Het
Nfkbie A T 17: 45,559,307 T193S probably damaging Het
Nlrp14 T G 7: 107,190,044 N672K probably benign Het
Olfr1453 T C 19: 13,028,075 T85A probably benign Het
Olfr32 A G 2: 90,138,324 Y272H probably damaging Het
Olfr323 A T 11: 58,625,434 I204N probably damaging Het
Olfr427 A T 1: 174,099,733 I92F probably damaging Het
Olfr597 A G 7: 103,320,449 T13A Het
Olfr913 A T 9: 38,594,904 I228L probably benign Het
Oscar T C 7: 3,611,150 T197A possibly damaging Het
P3h3 C A 6: 124,850,631 A481S possibly damaging Het
Pcdh8 T C 14: 79,771,251 probably null Het
Pcsk9 A T 4: 106,458,897 H116Q probably benign Het
Ptcd1 A G 5: 145,154,730 F520L possibly damaging Het
Rapgef2 T C 3: 79,069,273 T1261A probably benign Het
Ribc2 T A 15: 85,135,245 M76K probably benign Het
Sin3b A G 8: 72,753,225 E853G probably damaging Het
Slit2 A G 5: 48,256,838 D940G probably damaging Het
Smarcb1 T A 10: 75,897,539 N342Y probably damaging Het
Smurf2 A T 11: 106,836,095 I469N probably damaging Het
Spta1 T C 1: 174,246,499 Y2335H probably damaging Het
Suz12 C T 11: 80,024,975 R425C probably benign Het
Synpo G A 18: 60,629,823 A4V probably benign Het
Tet1 A C 10: 62,813,350 S157A possibly damaging Het
Themis A G 10: 28,761,419 E173G possibly damaging Het
Timmdc1 A T 16: 38,505,418 L197* probably null Het
Tmem63c T C 12: 87,069,158 F191S possibly damaging Het
Tnn G A 1: 160,110,347 T1200I probably benign Het
Traf6 A G 2: 101,697,192 H429R probably benign Het
Trem3 T C 17: 48,249,845 S115P probably benign Het
Trip11 A T 12: 101,885,380 N808K probably benign Het
Trub2 A T 2: 29,783,373 V106E probably damaging Het
Ugcg A G 4: 59,217,156 I227V probably benign Het
Vat1l G A 8: 114,236,799 probably null Het
Vmn1r184 T C 7: 26,267,399 M190T possibly damaging Het
Vmn2r3 T C 3: 64,275,532 T249A probably benign Het
Zfp729b A C 13: 67,593,883 S88A probably benign Het
Zfp995 T C 17: 21,880,200 Y351C probably damaging Het
Other mutations in Dnah12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Dnah12 APN 14 26771005 missense probably damaging 1.00
IGL01602:Dnah12 APN 14 26710275 splice site probably benign
IGL01681:Dnah12 APN 14 26722160 missense probably benign
IGL02082:Dnah12 APN 14 26707162 missense possibly damaging 0.79
IGL02140:Dnah12 APN 14 26716577 missense probably benign 0.20
IGL02170:Dnah12 APN 14 26773112 missense probably damaging 0.99
IGL02174:Dnah12 APN 14 26706917 missense probably benign 0.00
IGL02367:Dnah12 APN 14 26709161 missense probably benign 0.30
IGL02418:Dnah12 APN 14 26773722 missense probably damaging 1.00
IGL03039:Dnah12 APN 14 26724512 missense probably benign 0.02
IGL03066:Dnah12 APN 14 26697398 missense probably benign 0.06
drippings UTSW 14 26854804 missense probably damaging 1.00
grueben UTSW 14 26878079 missense probably damaging 1.00
BB010:Dnah12 UTSW 14 26766115 missense probably benign 0.00
BB020:Dnah12 UTSW 14 26766115 missense probably benign 0.00
F5770:Dnah12 UTSW 14 26773093 missense possibly damaging 0.95
FR4304:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
FR4340:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
FR4342:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
FR4589:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
IGL03055:Dnah12 UTSW 14 26872740 missense probably damaging 1.00
LCD18:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
R0003:Dnah12 UTSW 14 26772644 missense probably damaging 1.00
R0110:Dnah12 UTSW 14 26798899 missense probably damaging 1.00
R0302:Dnah12 UTSW 14 26799999 missense probably damaging 1.00
R0355:Dnah12 UTSW 14 26706117 intron probably null
R0364:Dnah12 UTSW 14 26724473 missense probably benign 0.10
R0469:Dnah12 UTSW 14 26798899 missense probably damaging 1.00
R0558:Dnah12 UTSW 14 26709310 missense probably benign 0.00
R0709:Dnah12 UTSW 14 26884265 splice site probably benign
R0734:Dnah12 UTSW 14 26800013 missense probably benign 0.00
R1273:Dnah12 UTSW 14 26739220 nonsense probably null
R1496:Dnah12 UTSW 14 26710248 missense probably benign
R1503:Dnah12 UTSW 14 26773692 missense probably damaging 1.00
R1535:Dnah12 UTSW 14 26816322 missense possibly damaging 0.91
R1608:Dnah12 UTSW 14 26766190 missense probably damaging 1.00
R1682:Dnah12 UTSW 14 26778883 missense possibly damaging 0.71
R1758:Dnah12 UTSW 14 26766114 missense probably benign 0.02
R1826:Dnah12 UTSW 14 26711019 missense probably benign 0.01
R1829:Dnah12 UTSW 14 26773023 missense probably damaging 1.00
R1829:Dnah12 UTSW 14 26800075 missense probably damaging 1.00
R1862:Dnah12 UTSW 14 26697398 missense probably benign 0.06
R1862:Dnah12 UTSW 14 26709257 missense probably benign 0.30
R1913:Dnah12 UTSW 14 26792264 splice site probably null
R1933:Dnah12 UTSW 14 26734495 missense probably damaging 0.98
R2006:Dnah12 UTSW 14 26814459 missense possibly damaging 0.95
R2045:Dnah12 UTSW 14 26781528 missense probably null 1.00
R2113:Dnah12 UTSW 14 26766141 missense probably damaging 1.00
R2125:Dnah12 UTSW 14 26724458 nonsense probably null
R2126:Dnah12 UTSW 14 26724458 nonsense probably null
R2207:Dnah12 UTSW 14 26781787 missense probably damaging 0.99
R2213:Dnah12 UTSW 14 26739330 missense probably benign 0.06
R2511:Dnah12 UTSW 14 26769950 missense possibly damaging 0.65
R2875:Dnah12 UTSW 14 26693470 missense probably benign 0.04
R2875:Dnah12 UTSW 14 26876950 missense probably benign 0.05
R3551:Dnah12 UTSW 14 26770972 missense probably benign 0.01
R3713:Dnah12 UTSW 14 26812790 missense probably benign
R3729:Dnah12 UTSW 14 26706065 missense probably benign 0.02
R3799:Dnah12 UTSW 14 26770923 missense probably damaging 1.00
R3846:Dnah12 UTSW 14 26710211 missense probably benign 0.00
R3892:Dnah12 UTSW 14 26856616 missense probably benign 0.03
R3921:Dnah12 UTSW 14 26771051 missense probably damaging 1.00
R3940:Dnah12 UTSW 14 26723599 missense probably benign
R4065:Dnah12 UTSW 14 26770448 missense probably benign 0.02
R4113:Dnah12 UTSW 14 26693567 missense probably damaging 0.98
R4249:Dnah12 UTSW 14 26709186 missense possibly damaging 0.70
R4259:Dnah12 UTSW 14 26798926 missense probably benign 0.01
R4260:Dnah12 UTSW 14 26798926 missense probably benign 0.01
R4348:Dnah12 UTSW 14 26814541 missense possibly damaging 0.94
R4457:Dnah12 UTSW 14 26815507 missense probably damaging 1.00
R4490:Dnah12 UTSW 14 26734603 missense possibly damaging 0.67
R4491:Dnah12 UTSW 14 26734603 missense possibly damaging 0.67
R4494:Dnah12 UTSW 14 26871855 missense probably damaging 0.99
R4523:Dnah12 UTSW 14 26770022 missense probably damaging 0.97
R4523:Dnah12 UTSW 14 26876958 missense possibly damaging 0.83
R4546:Dnah12 UTSW 14 26773014 missense probably damaging 1.00
R4584:Dnah12 UTSW 14 26772594 missense probably damaging 1.00
R4624:Dnah12 UTSW 14 26735758 missense possibly damaging 0.82
R4689:Dnah12 UTSW 14 26706839 missense probably benign 0.00
R4727:Dnah12 UTSW 14 26872317 missense probably damaging 1.00
R4732:Dnah12 UTSW 14 26781784 missense probably damaging 1.00
R4733:Dnah12 UTSW 14 26781784 missense probably damaging 1.00
R4851:Dnah12 UTSW 14 26716629 nonsense probably null
R4879:Dnah12 UTSW 14 26718046 critical splice donor site probably null
R4893:Dnah12 UTSW 14 26710170 missense possibly damaging 0.66
R4915:Dnah12 UTSW 14 26734570 missense probably damaging 1.00
R4927:Dnah12 UTSW 14 26861805 nonsense probably null
R4939:Dnah12 UTSW 14 26891524 missense probably damaging 1.00
R4962:Dnah12 UTSW 14 26716700 missense probably benign 0.00
R5011:Dnah12 UTSW 14 26710171 missense probably benign 0.03
R5013:Dnah12 UTSW 14 26710171 missense probably benign 0.03
R5043:Dnah12 UTSW 14 26884190 missense probably damaging 1.00
R5049:Dnah12 UTSW 14 26735697 missense probably benign 0.09
R5122:Dnah12 UTSW 14 26718000 missense probably benign 0.00
R5135:Dnah12 UTSW 14 26770477 missense probably damaging 0.99
R5149:Dnah12 UTSW 14 26850926 nonsense probably null
R5154:Dnah12 UTSW 14 26849363 missense probably benign 0.12
R5206:Dnah12 UTSW 14 26769985 missense probably damaging 1.00
R5307:Dnah12 UTSW 14 26693486 missense possibly damaging 0.49
R5330:Dnah12 UTSW 14 26773830 missense probably damaging 1.00
R5335:Dnah12 UTSW 14 26879738 missense probably damaging 1.00
R5339:Dnah12 UTSW 14 26814537 missense possibly damaging 0.83
R5354:Dnah12 UTSW 14 26774342 splice site probably null
R5389:Dnah12 UTSW 14 26735749 missense probably damaging 1.00
R5434:Dnah12 UTSW 14 26859299 missense probably damaging 1.00
R5466:Dnah12 UTSW 14 26771050 missense probably damaging 1.00
R5655:Dnah12 UTSW 14 26710269 missense probably benign 0.01
R5681:Dnah12 UTSW 14 26815495 missense probably benign 0.32
R5824:Dnah12 UTSW 14 26770518 critical splice donor site probably null
R5863:Dnah12 UTSW 14 26854921 missense probably damaging 1.00
R5890:Dnah12 UTSW 14 26706884 missense probably benign 0.09
R5912:Dnah12 UTSW 14 26770008 nonsense probably null
R5916:Dnah12 UTSW 14 26706918 missense possibly damaging 0.92
R5941:Dnah12 UTSW 14 26706867 missense probably benign 0.00
R5987:Dnah12 UTSW 14 26886871 missense possibly damaging 0.54
R5992:Dnah12 UTSW 14 26697341 missense probably benign 0.04
R6132:Dnah12 UTSW 14 26717911 missense probably damaging 1.00
R6136:Dnah12 UTSW 14 26875270 missense probably damaging 0.99
R6158:Dnah12 UTSW 14 26773685 missense possibly damaging 0.95
R6183:Dnah12 UTSW 14 26861769 missense probably damaging 1.00
R6191:Dnah12 UTSW 14 26710257 missense probably benign 0.03
R6235:Dnah12 UTSW 14 26854804 missense probably damaging 1.00
R6277:Dnah12 UTSW 14 26770482 missense probably damaging 1.00
R6332:Dnah12 UTSW 14 26717974 missense probably damaging 0.99
R6334:Dnah12 UTSW 14 26706834 missense possibly damaging 0.51
R6443:Dnah12 UTSW 14 26878051 missense probably benign 0.06
R6480:Dnah12 UTSW 14 26872455 missense probably damaging 1.00
R6530:Dnah12 UTSW 14 26735710 missense probably damaging 1.00
R6678:Dnah12 UTSW 14 26735692 missense probably damaging 1.00
R6709:Dnah12 UTSW 14 26872749 missense probably damaging 1.00
R6724:Dnah12 UTSW 14 26796223 missense probably benign 0.02
R6745:Dnah12 UTSW 14 26707228 missense probably damaging 0.99
R6788:Dnah12 UTSW 14 26801513 missense probably damaging 0.99
R6894:Dnah12 UTSW 14 26735749 missense probably damaging 1.00
R6912:Dnah12 UTSW 14 26878079 missense probably damaging 1.00
R6982:Dnah12 UTSW 14 26799076 intron probably null
R7001:Dnah12 UTSW 14 26879724 missense probably damaging 0.99
R7002:Dnah12 UTSW 14 26876998 missense probably damaging 1.00
R7017:Dnah12 UTSW 14 26735680 missense probably benign
R7107:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7108:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7121:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7122:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7135:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7135:Dnah12 UTSW 14 26801413 missense probably damaging 0.99
R7150:Dnah12 UTSW 14 26861732 missense probably damaging 0.99
R7188:Dnah12 UTSW 14 26814413 missense probably benign 0.04
R7201:Dnah12 UTSW 14 26814622 missense probably benign 0.08
R7202:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7204:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7204:Dnah12 UTSW 14 26781485 missense probably damaging 0.99
R7205:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7206:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7219:Dnah12 UTSW 14 26854880 missense probably damaging 0.99
R7337:Dnah12 UTSW 14 26766577 splice site probably null
R7339:Dnah12 UTSW 14 26872320 missense probably benign
R7363:Dnah12 UTSW 14 26724611 missense probably benign
R7426:Dnah12 UTSW 14 26724626 missense probably benign 0.01
R7579:Dnah12 UTSW 14 26770503 missense probably benign 0.05
R7655:Dnah12 UTSW 14 26859316 missense probably benign 0.21
R7656:Dnah12 UTSW 14 26859316 missense probably benign 0.21
R7694:Dnah12 UTSW 14 26781380 missense probably damaging 1.00
R7730:Dnah12 UTSW 14 26785933 missense probably damaging 1.00
R7837:Dnah12 UTSW 14 26796219 missense probably benign 0.01
R7855:Dnah12 UTSW 14 26829329 missense probably benign 0.14
R7870:Dnah12 UTSW 14 26856529 missense probably benign 0.00
R7933:Dnah12 UTSW 14 26766115 missense probably benign 0.00
R8192:Dnah12 UTSW 14 26706881 missense probably benign
R8263:Dnah12 UTSW 14 26891464 missense noncoding transcript
R8287:Dnah12 UTSW 14 26812603 missense probably benign
V7580:Dnah12 UTSW 14 26773093 missense possibly damaging 0.95
V7581:Dnah12 UTSW 14 26773093 missense possibly damaging 0.95
X0018:Dnah12 UTSW 14 26814480 missense probably damaging 1.00
X0027:Dnah12 UTSW 14 26816288 missense probably damaging 1.00
X0065:Dnah12 UTSW 14 26814645 missense possibly damaging 0.93
Z1177:Dnah12 UTSW 14 26875215 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCACCACAGTATGCAGTTATTTTC -3'
(R):5'- TGAGCTGCATCCTTAGCCAG -3'

Sequencing Primer
(F):5'- CGTTTTTAGACCAGAATTAGAGGAG -3'
(R):5'- GCCAGGAAATTAATTTGCTTCTTCTG -3'
Posted On2019-10-17