Incidental Mutation 'R0634:Gtf3c2'
ID58133
Institutional Source Beutler Lab
Gene Symbol Gtf3c2
Ensembl Gene ENSMUSG00000106864
Gene Namegeneral transcription factor IIIC, polypeptide 2, beta
SynonymsTFIIIC110, 2610510G03Rik, TFIIIC-BETA, 1300004C11Rik
MMRRC Submission 038823-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.572) question?
Stock #R0634 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location31156005-31180144 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 31159806 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 684 (R684*)
Ref Sequence ENSEMBL: ENSMUSP00000144489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088010] [ENSMUST00000101411] [ENSMUST00000202639]
Predicted Effect probably null
Transcript: ENSMUST00000043161
AA Change: R684*
SMART Domains Protein: ENSMUSP00000047210
Gene: ENSMUSG00000029144
AA Change: R684*

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
low complexity region 144 159 N/A INTRINSIC
low complexity region 232 243 N/A INTRINSIC
low complexity region 250 268 N/A INTRINSIC
low complexity region 292 311 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
WD40 495 551 6.39e0 SMART
WD40 573 623 1.6e0 SMART
WD40 641 681 3.37e-6 SMART
WD40 864 904 5.33e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000088010
AA Change: R641*
SMART Domains Protein: ENSMUSP00000085325
Gene: ENSMUSG00000106864
AA Change: R641*

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
low complexity region 144 159 N/A INTRINSIC
low complexity region 185 200 N/A INTRINSIC
low complexity region 207 225 N/A INTRINSIC
low complexity region 249 268 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
WD40 452 508 6.39e0 SMART
WD40 530 580 1.6e0 SMART
WD40 598 638 3.37e-6 SMART
WD40 821 861 5.33e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000101411
AA Change: R641*
SMART Domains Protein: ENSMUSP00000098957
Gene: ENSMUSG00000101678
AA Change: R641*

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
low complexity region 144 159 N/A INTRINSIC
low complexity region 185 200 N/A INTRINSIC
low complexity region 207 225 N/A INTRINSIC
low complexity region 249 268 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
WD40 452 508 6.39e0 SMART
WD40 530 580 1.6e0 SMART
WD40 598 638 3.37e-6 SMART
Blast:WD40 807 844 2e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136581
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201087
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201423
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202254
Predicted Effect probably null
Transcript: ENSMUST00000202639
AA Change: R684*
SMART Domains Protein: ENSMUSP00000144489
Gene: ENSMUSG00000106864
AA Change: R684*

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
low complexity region 144 159 N/A INTRINSIC
low complexity region 232 243 N/A INTRINSIC
low complexity region 250 268 N/A INTRINSIC
low complexity region 292 311 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
WD40 495 551 6.39e0 SMART
WD40 573 623 1.6e0 SMART
WD40 641 681 3.37e-6 SMART
WD40 864 904 5.33e0 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.2%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,314,491 I2958V possibly damaging Het
Adam21 C A 12: 81,560,352 W212L probably benign Het
Adcy2 A C 13: 68,727,945 H479Q possibly damaging Het
Adcy4 T C 14: 55,781,597 R168G probably benign Het
Atp13a2 T C 4: 141,006,929 probably benign Het
C1ra G A 6: 124,517,505 E304K possibly damaging Het
C87977 A G 4: 144,209,340 probably null Het
Cc2d2a A C 5: 43,681,381 probably benign Het
Cenpe T C 3: 135,246,827 L1426P probably damaging Het
Cntn1 A T 15: 92,314,563 R869* probably null Het
Creb3l2 A T 6: 37,334,348 probably benign Het
Crybg2 G A 4: 134,075,304 probably benign Het
Csmd1 A T 8: 16,226,391 F800I probably damaging Het
Dock6 G A 9: 21,841,527 T330I probably damaging Het
Ets2 G A 16: 95,716,156 E311K possibly damaging Het
Fbxo22 A T 9: 55,214,960 Q141L probably benign Het
Fer C T 17: 64,035,508 T223M probably benign Het
Gm13757 A T 2: 88,446,617 M107K probably benign Het
Gm9774 C T 3: 92,428,809 W125* probably null Het
Gtf3c1 A T 7: 125,657,477 probably benign Het
Hs6st3 T A 14: 119,869,062 L294* probably null Het
Ighg2c T G 12: 113,287,964 E181A unknown Het
Igkv6-15 A T 6: 70,406,779 probably benign Het
Lrmp A T 6: 145,174,628 H523L probably damaging Het
Map2k6 C T 11: 110,494,343 R178* probably null Het
Meikin T A 11: 54,390,483 D126E probably benign Het
Mgst1 A T 6: 138,156,331 T37S probably damaging Het
Mrc2 G A 11: 105,347,692 V1222M probably benign Het
Myom2 C A 8: 15,119,216 probably benign Het
Negr1 A G 3: 157,016,266 K159R possibly damaging Het
Nptx1 T C 11: 119,543,301 T320A possibly damaging Het
Olfr490 T C 7: 108,286,296 I277V probably benign Het
Olfr530 A T 7: 140,373,397 V71E possibly damaging Het
Pes1 C T 11: 3,977,794 probably benign Het
Pes1 T G 11: 3,977,795 probably benign Het
Pkhd1 A T 1: 20,117,474 Y3537N probably damaging Het
Poteg G A 8: 27,473,587 G289R probably benign Het
Rassf5 T C 1: 131,244,956 R59G probably damaging Het
Reln A T 5: 22,018,869 W961R probably damaging Het
Rhot2 G A 17: 25,842,028 H168Y possibly damaging Het
Ripk3 G T 14: 55,788,391 probably benign Het
Samm50 A G 15: 84,214,171 silent Het
Sap30bp T C 11: 115,957,403 I117T probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Sipa1l2 A T 8: 125,422,624 L1632* probably null Het
Sirt7 T C 11: 120,622,129 probably benign Het
Smg8 T C 11: 87,086,108 T216A possibly damaging Het
Sox9 A G 11: 112,784,942 Y319C probably damaging Het
Sspn G A 6: 145,961,151 A27T possibly damaging Het
Suco A G 1: 161,838,804 V509A possibly damaging Het
Svep1 C T 4: 58,070,661 C2375Y possibly damaging Het
Trbv21 T A 6: 41,203,050 probably benign Het
Uimc1 C T 13: 55,060,266 E455K possibly damaging Het
Upk3b A G 5: 136,040,076 T100A possibly damaging Het
Usp47 A G 7: 112,108,655 N1303D probably damaging Het
Vav1 A T 17: 57,303,862 D476V probably benign Het
Vmn1r68 A G 7: 10,527,235 V312A probably benign Het
Wdr62 A G 7: 30,270,174 V287A probably damaging Het
Zcchc4 C T 5: 52,783,208 P40S probably benign Het
Zfp326 T A 5: 105,886,203 Y26* probably null Het
Zfp592 A G 7: 81,038,071 H915R probably damaging Het
Other mutations in Gtf3c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00725:Gtf3c2 APN 5 31174408 missense probably damaging 1.00
IGL00832:Gtf3c2 APN 5 31173005 unclassified probably benign
IGL00904:Gtf3c2 APN 5 31172858 missense probably damaging 1.00
IGL00966:Gtf3c2 APN 5 31170173 critical splice donor site probably benign 0.00
IGL01061:Gtf3c2 APN 5 31168354 missense possibly damaging 0.94
IGL01148:Gtf3c2 APN 5 31159824 missense probably damaging 1.00
IGL01767:Gtf3c2 APN 5 31157635 missense probably benign 0.08
IGL02237:Gtf3c2 APN 5 31159053 splice site probably benign
IGL02458:Gtf3c2 APN 5 31159523 critical splice acceptor site probably null
IGL02888:Gtf3c2 APN 5 31173825 missense probably damaging 1.00
IGL03035:Gtf3c2 APN 5 31166014 missense possibly damaging 0.96
IGL03131:Gtf3c2 APN 5 31157620 missense probably damaging 0.98
R0534:Gtf3c2 UTSW 5 31158132 splice site probably benign
R0581:Gtf3c2 UTSW 5 31159518 nonsense probably null
R1172:Gtf3c2 UTSW 5 31168075 missense probably damaging 1.00
R1511:Gtf3c2 UTSW 5 31159102 missense probably benign 0.15
R1680:Gtf3c2 UTSW 5 31173868 missense probably damaging 1.00
R1726:Gtf3c2 UTSW 5 31169123 missense possibly damaging 0.82
R1831:Gtf3c2 UTSW 5 31168369 missense probably damaging 1.00
R2006:Gtf3c2 UTSW 5 31168096 missense probably damaging 0.99
R2437:Gtf3c2 UTSW 5 31159698 critical splice donor site probably null
R4732:Gtf3c2 UTSW 5 31160057 missense probably damaging 0.97
R4733:Gtf3c2 UTSW 5 31160057 missense probably damaging 0.97
R4787:Gtf3c2 UTSW 5 31157577 missense probably benign 0.03
R4817:Gtf3c2 UTSW 5 31174090 critical splice acceptor site probably null
R4863:Gtf3c2 UTSW 5 31159233 intron probably benign
R4926:Gtf3c2 UTSW 5 31169123 missense possibly damaging 0.82
R5508:Gtf3c2 UTSW 5 31174461 nonsense probably null
R5704:Gtf3c2 UTSW 5 31159110 missense probably damaging 1.00
R5737:Gtf3c2 UTSW 5 31168249 critical splice donor site probably null
R5868:Gtf3c2 UTSW 5 31168081 missense possibly damaging 0.94
R6174:Gtf3c2 UTSW 5 31158211 missense probably damaging 1.00
R6705:Gtf3c2 UTSW 5 31166008 missense possibly damaging 0.93
R6782:Gtf3c2 UTSW 5 31169836 missense probably benign 0.01
R6893:Gtf3c2 UTSW 5 31166378 missense probably benign 0.06
R7363:Gtf3c2 UTSW 5 31170256 missense probably damaging 1.00
R7474:Gtf3c2 UTSW 5 31167756 missense probably damaging 1.00
R7578:Gtf3c2 UTSW 5 31172997 missense probably benign
R7685:Gtf3c2 UTSW 5 31168267 missense probably damaging 1.00
R7711:Gtf3c2 UTSW 5 31170189 missense probably damaging 1.00
R7754:Gtf3c2 UTSW 5 31172831 missense probably benign 0.38
R7825:Gtf3c2 UTSW 5 31158371 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCCACAGAGCCCGTAACTGAAAAG -3'
(R):5'- ATGACCAGGCTGTCCGTACAATTC -3'

Sequencing Primer
(F):5'- TTCTTCCAAAATTCAGATACCTCAGC -3'
(R):5'- CAATTCAGTGGTGCAAAGCTAAC -3'
Posted On2013-07-11