Incidental Mutation 'R7472:Cchcr1'
ID581340
Institutional Source Beutler Lab
Gene Symbol Cchcr1
Ensembl Gene ENSMUSG00000040312
Gene Namecoiled-coil alpha-helical rod protein 1
SynonymsHcr
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.465) question?
Stock #R7472 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location35517100-35531015 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 35528351 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 479 (A479D)
Ref Sequence ENSEMBL: ENSMUSP00000132028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025273] [ENSMUST00000045956] [ENSMUST00000164242] [ENSMUST00000173903]
Predicted Effect probably benign
Transcript: ENSMUST00000025273
SMART Domains Protein: ENSMUSP00000025273
Gene: ENSMUSG00000024409

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
Pfam:SPR1 22 135 1.3e-56 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000045956
AA Change: A479D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046612
Gene: ENSMUSG00000040312
AA Change: A479D

DomainStartEndE-ValueType
Pfam:HCR 27 767 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164242
AA Change: A479D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132028
Gene: ENSMUSG00000040312
AA Change: A479D

DomainStartEndE-ValueType
Pfam:HCR 27 767 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173903
AA Change: A562D

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000133407
Gene: ENSMUSG00000040312
AA Change: A562D

DomainStartEndE-ValueType
Pfam:HCR 110 855 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (99/100)
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik A G 2: 19,540,408 I78T probably benign Het
4921524J17Rik G A 8: 85,432,809 probably benign Het
4932415D10Rik T C 10: 82,283,587 I4530V probably benign Het
4932438H23Rik T C 16: 91,055,856 T131A probably benign Het
Acbd6 G T 1: 155,587,467 E138* probably null Het
Ago3 A G 4: 126,345,517 V847A probably damaging Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Als2cl C A 9: 110,898,106 H913Q probably benign Het
Atf6 A C 1: 170,815,491 S360R possibly damaging Het
Atm G C 9: 53,448,125 N2789K possibly damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Bpifa6 A T 2: 153,989,329 I272F possibly damaging Het
Cabin1 G T 10: 75,658,647 P1633T probably damaging Het
Camsap2 A G 1: 136,281,393 V119A probably damaging Het
Ccdc40 A G 11: 119,263,148 E1082G probably benign Het
Chpt1 C T 10: 88,476,368 V349I probably benign Het
Cldn13 A T 5: 134,915,121 I70K probably damaging Het
Col6a6 T A 9: 105,782,423 D441V probably damaging Het
Cpne5 G T 17: 29,204,740 T138K probably benign Het
Creb3l3 A T 10: 81,089,467 probably null Het
Cst10 C T 2: 149,405,576 L71F probably benign Het
Ctsb T C 14: 63,138,101 V172A probably benign Het
Cyp19a1 A G 9: 54,166,993 Y426H possibly damaging Het
Cyth4 T C 15: 78,605,894 F72S probably damaging Het
D430041D05Rik G T 2: 104,410,139 Q9K unknown Het
Dnah1 T A 14: 31,261,590 I4099F probably damaging Het
Dnah1 T A 14: 31,300,791 I1130F possibly damaging Het
Dnah12 A G 14: 26,856,635 K3117R probably benign Het
Dpf3 A T 12: 83,272,385 S275R probably benign Het
Dst A G 1: 34,218,497 N2450S probably benign Het
Dync1h1 C T 12: 110,665,675 R4460W probably damaging Het
Ecm1 A C 3: 95,735,320 C414G possibly damaging Het
Eef2 G A 10: 81,179,550 D302N probably benign Het
Egf T C 3: 129,686,263 D1038G possibly damaging Het
Epm2aip1 T C 9: 111,272,399 S147P probably damaging Het
Esam C A 9: 37,537,567 P324T possibly damaging Het
Fam160b1 A G 19: 57,368,585 Y36C probably damaging Het
Fbxo36 A G 1: 84,896,580 D99G probably damaging Het
Fhad1 G A 4: 141,964,626 R400C probably benign Het
Fndc3b T C 3: 27,461,744 T638A probably benign Het
Gba2 T C 4: 43,568,967 T563A probably benign Het
Gm11237 G A 4: 73,624,499 G79S probably damaging Het
Gm156 A T 6: 129,775,382 F57I probably benign Het
Gm8180 T A 14: 43,783,637 N38I possibly damaging Het
Hs3st4 A G 7: 124,397,026 E305G probably damaging Het
Ireb2 T A 9: 54,884,054 F191I probably benign Het
Irx3 T G 8: 91,799,997 T360P probably benign Het
Itpr1 T A 6: 108,403,396 I1375N probably benign Het
Lama4 A T 10: 39,087,373 I1314F possibly damaging Het
Lamb2 C A 9: 108,486,148 A842D probably benign Het
Ldlrap1 A G 4: 134,758,996 Y51H possibly damaging Het
Leo1 A G 9: 75,448,341 D321G probably damaging Het
Lrrc14b A G 13: 74,363,107 S285P probably damaging Het
Macf1 A G 4: 123,433,067 V4881A probably benign Het
Mfsd2b A T 12: 4,866,481 F333I probably damaging Het
Micall1 T C 15: 79,122,560 S196P unknown Het
Mrps21 T C 3: 95,862,798 N73S probably benign Het
Msln C T 17: 25,750,734 V341M possibly damaging Het
Mybpc3 A T 2: 91,131,656 M840L probably damaging Het
Myo7a A C 7: 98,064,793 F1613V probably damaging Het
Naprt C T 15: 75,891,758 probably null Het
Nbr1 T C 11: 101,571,939 V572A probably damaging Het
Nfkbie A T 17: 45,559,307 T193S probably damaging Het
Nlrp14 T G 7: 107,190,044 N672K probably benign Het
Olfr1453 T C 19: 13,028,075 T85A probably benign Het
Olfr32 A G 2: 90,138,324 Y272H probably damaging Het
Olfr323 A T 11: 58,625,434 I204N probably damaging Het
Olfr427 A T 1: 174,099,733 I92F probably damaging Het
Olfr597 A G 7: 103,320,449 T13A Het
Olfr913 A T 9: 38,594,904 I228L probably benign Het
Oscar T C 7: 3,611,150 T197A possibly damaging Het
P3h3 C A 6: 124,850,631 A481S possibly damaging Het
Pcdh8 T C 14: 79,771,251 probably null Het
Pcsk9 A T 4: 106,458,897 H116Q probably benign Het
Ptcd1 A G 5: 145,154,730 F520L possibly damaging Het
Rapgef2 T C 3: 79,069,273 T1261A probably benign Het
Ribc2 T A 15: 85,135,245 M76K probably benign Het
Sin3b A G 8: 72,753,225 E853G probably damaging Het
Slit2 A G 5: 48,256,838 D940G probably damaging Het
Smarcb1 T A 10: 75,897,539 N342Y probably damaging Het
Smurf2 A T 11: 106,836,095 I469N probably damaging Het
Spta1 T C 1: 174,246,499 Y2335H probably damaging Het
Suz12 C T 11: 80,024,975 R425C probably benign Het
Synpo G A 18: 60,629,823 A4V probably benign Het
Tet1 A C 10: 62,813,350 S157A possibly damaging Het
Themis A G 10: 28,761,419 E173G possibly damaging Het
Timmdc1 A T 16: 38,505,418 L197* probably null Het
Tmem63c T C 12: 87,069,158 F191S possibly damaging Het
Tnn G A 1: 160,110,347 T1200I probably benign Het
Traf6 A G 2: 101,697,192 H429R probably benign Het
Trem3 T C 17: 48,249,845 S115P probably benign Het
Trip11 A T 12: 101,885,380 N808K probably benign Het
Trub2 A T 2: 29,783,373 V106E probably damaging Het
Ugcg A G 4: 59,217,156 I227V probably benign Het
Vat1l G A 8: 114,236,799 probably null Het
Vmn1r184 T C 7: 26,267,399 M190T possibly damaging Het
Vmn2r3 T C 3: 64,275,532 T249A probably benign Het
Zfp729b A C 13: 67,593,883 S88A probably benign Het
Zfp995 T C 17: 21,880,200 Y351C probably damaging Het
Other mutations in Cchcr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Cchcr1 APN 17 35528572 missense possibly damaging 0.92
IGL02723:Cchcr1 APN 17 35530802 missense probably benign 0.00
IGL02806:Cchcr1 APN 17 35525256 splice site probably benign
IGL03055:Cchcr1 UTSW 17 35526619 missense probably benign 0.33
R0569:Cchcr1 UTSW 17 35528968 critical splice donor site probably null
R1438:Cchcr1 UTSW 17 35530560 critical splice donor site probably null
R2055:Cchcr1 UTSW 17 35526420 missense probably damaging 1.00
R2511:Cchcr1 UTSW 17 35530513 missense probably benign 0.01
R3910:Cchcr1 UTSW 17 35525336 missense probably damaging 1.00
R3911:Cchcr1 UTSW 17 35525336 missense probably damaging 1.00
R3913:Cchcr1 UTSW 17 35525336 missense probably damaging 1.00
R5590:Cchcr1 UTSW 17 35526680 missense probably damaging 1.00
R5821:Cchcr1 UTSW 17 35528848 missense probably damaging 1.00
R5940:Cchcr1 UTSW 17 35524993 missense probably damaging 1.00
R5941:Cchcr1 UTSW 17 35524993 missense probably damaging 1.00
R6006:Cchcr1 UTSW 17 35524700 missense possibly damaging 0.83
R6114:Cchcr1 UTSW 17 35525330 missense probably damaging 0.98
R6146:Cchcr1 UTSW 17 35528578 missense possibly damaging 0.92
R6262:Cchcr1 UTSW 17 35530516 missense probably benign 0.04
R6369:Cchcr1 UTSW 17 35528176 missense probably damaging 0.99
R6478:Cchcr1 UTSW 17 35524703 missense possibly damaging 0.71
R6827:Cchcr1 UTSW 17 35530405 missense possibly damaging 0.71
R6860:Cchcr1 UTSW 17 35529118 missense possibly damaging 0.85
R7109:Cchcr1 UTSW 17 35517941 critical splice donor site probably null
R7276:Cchcr1 UTSW 17 35529134 missense possibly damaging 0.46
R7341:Cchcr1 UTSW 17 35526713 missense probably benign 0.00
R7404:Cchcr1 UTSW 17 35524796 missense probably benign 0.09
R7666:Cchcr1 UTSW 17 35526486 missense probably benign 0.01
R8189:Cchcr1 UTSW 17 35526666 missense probably benign
X0025:Cchcr1 UTSW 17 35526676 missense probably benign 0.13
Z1177:Cchcr1 UTSW 17 35528663 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTAAGGGTACGTAGAGCAACTG -3'
(R):5'- TCAACGCTCAGGTCTGTGTC -3'

Sequencing Primer
(F):5'- AGAGCAACTGTGGGGTTTCC -3'
(R):5'- CGCTCAGGTCTGTGTCCAGTG -3'
Posted On2019-10-17