Incidental Mutation 'R7499:Cela3a'
ID581362
Institutional Source Beutler Lab
Gene Symbol Cela3a
Ensembl Gene ENSMUSG00000078520
Gene Namechymotrypsin-like elastase family, member 3A
SynonymsGm13011
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R7499 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location137401554-137409791 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 137405639 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 101 (I101F)
Ref Sequence ENSEMBL: ENSMUSP00000024200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024200]
Predicted Effect probably damaging
Transcript: ENSMUST00000024200
AA Change: I101F

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000024200
Gene: ENSMUSG00000078520
AA Change: I101F

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Tryp_SPc 27 276 2.6e-82 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Elastases form a subfamily of serine proteases that hydrolyze many proteins in addition to elastin. Humans have six elastase genes which encode the structurally similar proteins elastase 1, 2, 2A, 2B, 3A, and 3B. Unlike other elastases, elastase 3A has little elastolytic activity. Like most of the human elastases, elastase 3A is secreted from the pancreas as a zymogen and, like other serine proteases such as trypsin, chymotrypsin and kallikrein, it has a digestive function in the intestine. Elastase 3A preferentially cleaves proteins after alanine residues. Elastase 3A may also function in the intestinal transport and metabolism of cholesterol. Both elastase 3A and elastase 3B have been referred to as protease E and as elastase 1. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T A 9: 55,999,902 D180V possibly damaging Het
Abat T C 16: 8,603,754 probably null Het
Ankfn1 G A 11: 89,391,750 T357I probably benign Het
Armc3 C T 2: 19,285,979 T423I probably benign Het
Asb6 T C 2: 30,824,460 T213A possibly damaging Het
Atp11a T C 8: 12,832,575 C488R probably benign Het
Bag6 G A 17: 35,144,392 R736H probably benign Het
Bche G A 3: 73,701,898 P65L probably damaging Het
Cep170 A T 1: 176,774,462 D359E probably damaging Het
Chfr T C 5: 110,151,683 V314A probably benign Het
Clpb T C 7: 101,722,728 F224L possibly damaging Het
Coro2a T C 4: 46,539,188 K527R probably benign Het
Cpa5 A G 6: 30,630,857 T373A possibly damaging Het
Ctsd A T 7: 142,383,412 probably null Het
Dlx5 G A 6: 6,878,340 S230F possibly damaging Het
Dlx5 A C 6: 6,878,341 S230A probably benign Het
Dmc1 G T 15: 79,602,420 S11* probably null Het
Dnah1 G A 14: 31,315,122 Q256* probably null Het
Dnah3 A G 7: 120,060,912 F846L probably damaging Het
Dnah5 A T 15: 28,302,450 I1618F probably damaging Het
Emsy A G 7: 98,630,331 V267A possibly damaging Het
Fgfr3 GGACCTCTCCGTG GG 5: 33,735,422 probably null Het
Frem1 T C 4: 83,005,770 I317M probably damaging Het
G6pc C A 11: 101,376,694 Y323* probably null Het
Gm5114 A G 7: 39,409,065 C377R possibly damaging Het
Gm7361 C A 5: 26,261,190 H183Q probably benign Het
Hmbox1 A G 14: 64,896,677 V158A possibly damaging Het
Hmg20a A G 9: 56,488,943 R340G unknown Het
Ifi206 T A 1: 173,482,041 I130F Het
Ifnb1 T C 4: 88,522,674 N34S probably benign Het
Il16 T C 7: 83,674,494 K283E probably damaging Het
Maf T C 8: 115,693,181 D374G probably benign Het
Mettl14 A G 3: 123,374,854 I179T probably benign Het
Mpped1 G A 15: 83,800,050 R91H probably damaging Het
Nop2 C A 6: 125,144,208 P651Q possibly damaging Het
Olfr486 A G 7: 108,171,800 *315Q probably null Het
Phkg1 G A 5: 129,873,268 Q89* probably null Het
Phykpl T A 11: 51,591,458 V133E probably damaging Het
Polr3gl A T 3: 96,579,821 Y183N probably benign Het
Pqlc2 T A 4: 139,306,512 D32V probably damaging Het
Rab13 A G 3: 90,225,533 T187A probably benign Het
Ripor2 A G 13: 24,693,772 M252V probably damaging Het
Sec61a2 T C 2: 5,877,914 N186S probably benign Het
Serpinb5 T C 1: 106,872,389 probably null Het
Serpine3 G A 14: 62,665,027 W29* probably null Het
Sh2b3 T C 5: 121,818,473 R382G probably damaging Het
Slc7a5 A G 8: 121,883,722 L451P probably damaging Het
Slco1a5 T C 6: 142,262,531 probably null Het
Tep1 G A 14: 50,853,590 A695V probably damaging Het
Tnik T C 3: 28,630,594 V857A possibly damaging Het
Trdn A T 10: 33,196,101 M255L probably benign Het
Tsc22d4 G A 5: 137,747,723 S203N probably benign Het
Tsfm T C 10: 127,022,548 E316G possibly damaging Het
Tvp23b T C 11: 62,879,463 probably benign Het
Vgf C A 5: 137,032,245 D420E probably damaging Het
Zan G A 5: 137,464,356 P854S probably benign Het
Zfp831 T C 2: 174,644,023 S164P possibly damaging Het
Other mutations in Cela3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02830:Cela3a APN 4 137401635 missense probably benign 0.00
IGL02869:Cela3a APN 4 137403834 missense probably benign 0.13
IGL02968:Cela3a APN 4 137403821 missense probably damaging 1.00
R0496:Cela3a UTSW 4 137404468 missense probably damaging 1.00
R1681:Cela3a UTSW 4 137402684 critical splice acceptor site probably null
R2092:Cela3a UTSW 4 137404426 missense probably benign 0.03
R2277:Cela3a UTSW 4 137405876 missense possibly damaging 0.88
R4766:Cela3a UTSW 4 137402675 missense unknown
R4960:Cela3a UTSW 4 137402648 nonsense probably null
R6666:Cela3a UTSW 4 137403864 missense probably benign 0.04
R6842:Cela3a UTSW 4 137405668 missense probably benign 0.00
R6957:Cela3a UTSW 4 137408130 missense probably damaging 1.00
R7347:Cela3a UTSW 4 137402606 missense possibly damaging 0.95
R7425:Cela3a UTSW 4 137405588 missense probably benign 0.00
R7543:Cela3a UTSW 4 137402572 missense probably damaging 0.99
R7702:Cela3a UTSW 4 137408190 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTTCTTGCAGCTACCCAC -3'
(R):5'- TGTGGTGGCTCCCTCATTAC -3'

Sequencing Primer
(F):5'- ACAGCCCATGCCACTTGG -3'
(R):5'- GGGCCACTGCATCATGTAAGTTC -3'
Posted On2019-10-17