Mutagenetix > Incidental Mutations

Incidental Mutation 'R7499:Chfr'

581366

Institutional Source

Beutler Lab

Gene Symbol

Chfr

Ensembl Gene

ENSMUSG00000014668

Gene Name

checkpoint with forkhead and ring finger domains

Synonyms

RNF116, 5730484M20Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.215) question?

Stock #

R7499 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

110135842-110171972 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 110151683 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 314 (V314A)

Ref Sequence

ENSEMBL: ENSMUSP00000108138 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014812] [ENSMUST00000112519] [ENSMUST00000198066] [ENSMUST00000198633] [ENSMUST00000199557] [ENSMUST00000199672]

AlphaFold

Q810L3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000014812
AA Change: V314A

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000014812
Gene: ENSMUSG00000014668
AA Change: V314A

Domain	Start	End	E-Value	Type
low complexity region	6	15	N/A	INTRINSIC
FHA	37	89	1.09e-6	SMART
low complexity region	203	215	N/A	INTRINSIC
RING	303	341	2.63e-4	SMART
low complexity region	396	421	N/A	INTRINSIC
RING	443	512	3.53e0	SMART
Blast:VWA	593	655	3e-12	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000112519
AA Change: V314A

PolyPhen 2 Score 0.399 (Sensitivity: 0.89; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000108138
Gene: ENSMUSG00000014668
AA Change: V314A

Domain	Start	End	E-Value	Type
low complexity region	6	15	N/A	INTRINSIC
FHA	37	89	1.09e-6	SMART
low complexity region	203	215	N/A	INTRINSIC
RING	303	341	2.63e-4	SMART
low complexity region	396	421	N/A	INTRINSIC
RING	443	513	3.63e0	SMART
Blast:VWA	594	656	3e-12	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000198066

Predicted Effect

probably damaging
Transcript: ENSMUST00000198633
AA Change: V242A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000143480
Gene: ENSMUSG00000014668
AA Change: V242A

Domain	Start	End	E-Value	Type
low complexity region	6	15	N/A	INTRINSIC
FHA	37	89	1.09e-6	SMART
RING	231	269	2.63e-4	SMART
low complexity region	324	349	N/A	INTRINSIC
RING	371	441	3.63e0	SMART
Blast:VWA	522	584	2e-12	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000199557

SMART Domains

Protein: ENSMUSP00000143113
Gene: ENSMUSG00000014668

Domain	Start	End	E-Value	Type
SCOP:d1lgpa_	14	44	4e-5	SMART
PDB:1LGQ\|B	16	44	1e-10	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000199672

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin-protein ligase required for the maintenance of the antephase checkpoint that regulates cell cycle entry into mitosis and, therefore, may play a key role in cell cycle progression and tumorigenesis. The encoded protein has an N-terminal forkhead-associated domain, a central RING-finger domain, and a cysteine-rich C-terminal region. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous null mice and MEFs display increased tumor incidence and inducibility, premature death, increased chromosomal instability, and cell cycle abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930563M21Rik	T	A	9: 55,999,902	D180V	possibly damaging	Het
Abat	T	C	16: 8,603,754		probably null	Het
Ankfn1	G	A	11: 89,391,750	T357I	probably benign	Het
Armc3	C	T	2: 19,285,979	T423I	probably benign	Het
Asb6	T	C	2: 30,824,460	T213A	possibly damaging	Het
Atp11a	T	C	8: 12,832,575	C488R	probably benign	Het
Bag6	G	A	17: 35,144,392	R736H	probably benign	Het
Bche	G	A	3: 73,701,898	P65L	probably damaging	Het
Cela3a	T	A	4: 137,405,639	I101F	probably damaging	Het
Cep170	A	T	1: 176,774,462	D359E	probably damaging	Het
Clpb	T	C	7: 101,722,728	F224L	possibly damaging	Het
Coro2a	T	C	4: 46,539,188	K527R	probably benign	Het
Cpa5	A	G	6: 30,630,857	T373A	possibly damaging	Het
Ctsd	A	T	7: 142,383,412		probably null	Het
Dlx5	G	A	6: 6,878,340	S230F	possibly damaging	Het
Dlx5	A	C	6: 6,878,341	S230A	probably benign	Het
Dmc1	G	T	15: 79,602,420	S11*	probably null	Het
Dnah1	G	A	14: 31,315,122	Q256*	probably null	Het
Dnah3	A	G	7: 120,060,912	F846L	probably damaging	Het
Dnah5	A	T	15: 28,302,450	I1618F	probably damaging	Het
Emsy	A	G	7: 98,630,331	V267A	possibly damaging	Het
Fgfr3	GGACCTCTCCGTG	GG	5: 33,735,422		probably null	Het
Frem1	T	C	4: 83,005,770	I317M	probably damaging	Het
G6pc	C	A	11: 101,376,694	Y323*	probably null	Het
Gm5114	A	G	7: 39,409,065	C377R	possibly damaging	Het
Gm7361	C	A	5: 26,261,190	H183Q	probably benign	Het
Hmbox1	A	G	14: 64,896,677	V158A	possibly damaging	Het
Hmg20a	A	G	9: 56,488,943	R340G	unknown	Het
Ifi206	T	A	1: 173,482,041	I130F		Het
Ifnb1	T	C	4: 88,522,674	N34S	probably benign	Het
Il16	T	C	7: 83,674,494	K283E	probably damaging	Het
Maf	T	C	8: 115,693,181	D374G	probably benign	Het
Mettl14	A	G	3: 123,374,854	I179T	probably benign	Het
Mpped1	G	A	15: 83,800,050	R91H	probably damaging	Het
Nop2	C	A	6: 125,144,208	P651Q	possibly damaging	Het
Olfr486	A	G	7: 108,171,800	*315Q	probably null	Het
Phkg1	G	A	5: 129,873,268	Q89*	probably null	Het
Phykpl	T	A	11: 51,591,458	V133E	probably damaging	Het
Polr3gl	A	T	3: 96,579,821	Y183N	probably benign	Het
Pqlc2	T	A	4: 139,306,512	D32V	probably damaging	Het
Rab13	A	G	3: 90,225,533	T187A	probably benign	Het
Ripor2	A	G	13: 24,693,772	M252V	probably damaging	Het
Sec61a2	T	C	2: 5,877,914	N186S	probably benign	Het
Serpinb5	T	C	1: 106,872,389		probably null	Het
Serpine3	G	A	14: 62,665,027	W29*	probably null	Het
Sh2b3	T	C	5: 121,818,473	R382G	probably damaging	Het
Slc7a5	A	G	8: 121,883,722	L451P	probably damaging	Het
Slco1a5	T	C	6: 142,262,531		probably null	Het
Tep1	G	A	14: 50,853,590	A695V	probably damaging	Het
Tnik	T	C	3: 28,630,594	V857A	possibly damaging	Het
Trdn	A	T	10: 33,196,101	M255L	probably benign	Het
Tsc22d4	G	A	5: 137,747,723	S203N	probably benign	Het
Tsfm	T	C	10: 127,022,548	E316G	possibly damaging	Het
Tvp23b	T	C	11: 62,879,463		probably benign	Het
Vgf	C	A	5: 137,032,245	D420E	probably damaging	Het
Zan	G	A	5: 137,464,356	P854S	probably benign	Het
Zfp831	T	C	2: 174,644,023	S164P	possibly damaging	Het

Other mutations in Chfr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01333:Chfr	APN	5	110143573	missense	possibly damaging	0.94
IGL01479:Chfr	APN	5	110144993	unclassified	probably benign
IGL02543:Chfr	APN	5	110143547	splice site	probably null
IGL02657:Chfr	APN	5	110154839	missense	probably damaging	1.00
IGL03057:Chfr	APN	5	110143609	missense	probably benign	0.14
PIT4445001:Chfr	UTSW	5	110151677	missense	possibly damaging	0.88
R0938:Chfr	UTSW	5	110164058	missense	probably damaging	1.00
R1346:Chfr	UTSW	5	110140447	missense	probably damaging	1.00
R1561:Chfr	UTSW	5	110158808	missense	probably benign	0.05
R1602:Chfr	UTSW	5	110151665	missense	probably benign	0.26
R1658:Chfr	UTSW	5	110153169	missense	probably damaging	1.00
R2134:Chfr	UTSW	5	110144761	splice site	probably null
R2234:Chfr	UTSW	5	110170863	missense	probably damaging	1.00
R4371:Chfr	UTSW	5	110136168	missense	probably damaging	0.99
R4420:Chfr	UTSW	5	110170880	nonsense	probably null
R4666:Chfr	UTSW	5	110144867	nonsense	probably null
R4742:Chfr	UTSW	5	110143598	missense	probably benign	0.04
R4809:Chfr	UTSW	5	110158834	missense	probably damaging	1.00
R5490:Chfr	UTSW	5	110153129	missense	possibly damaging	0.88
R5581:Chfr	UTSW	5	110153282	critical splice donor site	probably null
R5820:Chfr	UTSW	5	110162739	missense	possibly damaging	0.94
R6012:Chfr	UTSW	5	110144651	critical splice donor site	probably null
R7128:Chfr	UTSW	5	110143636	missense	probably benign	0.33
R7166:Chfr	UTSW	5	110158805	missense	probably benign
R7278:Chfr	UTSW	5	110140360	missense	probably benign	0.23
R7393:Chfr	UTSW	5	110152358	missense	probably damaging	0.98
R7422:Chfr	UTSW	5	110162705	splice site	probably null
R8224:Chfr	UTSW	5	110160243	critical splice donor site	probably null
R8264:Chfr	UTSW	5	110152434	missense	possibly damaging	0.86
R8325:Chfr	UTSW	5	110162763	nonsense	probably null
R8333:Chfr	UTSW	5	110154937	missense	probably benign	0.05
R8823:Chfr	UTSW	5	110152392	missense	probably damaging	0.96
R9024:Chfr	UTSW	5	110158832	missense	probably benign	0.26
R9419:Chfr	UTSW	5	110169190
X0013:Chfr	UTSW	5	110151579	missense	probably benign	0.19
Z1176:Chfr	UTSW	5	110144895	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CTGTGACTACTGGGACTTGTC -3'
(R):5'- GGCAAAGACCAGGTCTGTTG -3'

Sequencing Primer
(F):5'- ACTACTGGGACTTGTCTTTTGTC -3'
(R):5'- TGGCCTGTGTCAGTCAAAAC -3'

Posted On

2019-10-17