Incidental Mutation 'R7499:Nop2'
ID581375
Institutional Source Beutler Lab
Gene Symbol Nop2
Ensembl Gene ENSMUSG00000038279
Gene NameNOP2 nucleolar protein
Synonyms120kDa, Nol1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R7499 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location125131909-125144753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 125144208 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 651 (P651Q)
Ref Sequence ENSEMBL: ENSMUSP00000047123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044200] [ENSMUST00000117675] [ENSMUST00000119527] [ENSMUST00000144364]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044200
AA Change: P651Q

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000047123
Gene: ENSMUSG00000038279
AA Change: P651Q

DomainStartEndE-ValueType
low complexity region 41 57 N/A INTRINSIC
low complexity region 97 109 N/A INTRINSIC
low complexity region 166 176 N/A INTRINSIC
Pfam:Methyltr_RsmF_N 268 359 2.9e-12 PFAM
Pfam:Nol1_Nop2_Fmu 362 570 2e-86 PFAM
Pfam:P120R 609 630 2.7e-11 PFAM
Pfam:P120R 663 685 1.1e-12 PFAM
low complexity region 729 745 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117675
SMART Domains Protein: ENSMUSP00000113088
Gene: ENSMUSG00000038271

DomainStartEndE-ValueType
coiled coil region 21 58 N/A INTRINSIC
low complexity region 105 126 N/A INTRINSIC
coiled coil region 190 242 N/A INTRINSIC
low complexity region 362 375 N/A INTRINSIC
low complexity region 381 392 N/A INTRINSIC
PDB:1GK4|F 393 459 6e-7 PDB
low complexity region 474 497 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119527
SMART Domains Protein: ENSMUSP00000113376
Gene: ENSMUSG00000038271

DomainStartEndE-ValueType
coiled coil region 21 58 N/A INTRINSIC
low complexity region 105 126 N/A INTRINSIC
coiled coil region 190 242 N/A INTRINSIC
low complexity region 359 372 N/A INTRINSIC
low complexity region 378 389 N/A INTRINSIC
PDB:1GK4|F 390 456 6e-7 PDB
low complexity region 471 494 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144364
SMART Domains Protein: ENSMUSP00000116701
Gene: ENSMUSG00000038271

DomainStartEndE-ValueType
coiled coil region 21 58 N/A INTRINSIC
low complexity region 105 126 N/A INTRINSIC
coiled coil region 190 242 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148835
SMART Domains Protein: ENSMUSP00000115080
Gene: ENSMUSG00000038271

DomainStartEndE-ValueType
Filament 34 348 4.99e-2 SMART
low complexity region 356 379 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit complete prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T A 9: 55,999,902 D180V possibly damaging Het
Abat T C 16: 8,603,754 probably null Het
Ankfn1 G A 11: 89,391,750 T357I probably benign Het
Armc3 C T 2: 19,285,979 T423I probably benign Het
Asb6 T C 2: 30,824,460 T213A possibly damaging Het
Atp11a T C 8: 12,832,575 C488R probably benign Het
Bag6 G A 17: 35,144,392 R736H probably benign Het
Bche G A 3: 73,701,898 P65L probably damaging Het
Cela3a T A 4: 137,405,639 I101F probably damaging Het
Cep170 A T 1: 176,774,462 D359E probably damaging Het
Chfr T C 5: 110,151,683 V314A probably benign Het
Clpb T C 7: 101,722,728 F224L possibly damaging Het
Coro2a T C 4: 46,539,188 K527R probably benign Het
Cpa5 A G 6: 30,630,857 T373A possibly damaging Het
Ctsd A T 7: 142,383,412 probably null Het
Dlx5 G A 6: 6,878,340 S230F possibly damaging Het
Dlx5 A C 6: 6,878,341 S230A probably benign Het
Dmc1 G T 15: 79,602,420 S11* probably null Het
Dnah1 G A 14: 31,315,122 Q256* probably null Het
Dnah3 A G 7: 120,060,912 F846L probably damaging Het
Dnah5 A T 15: 28,302,450 I1618F probably damaging Het
Emsy A G 7: 98,630,331 V267A possibly damaging Het
Fgfr3 GGACCTCTCCGTG GG 5: 33,735,422 probably null Het
Frem1 T C 4: 83,005,770 I317M probably damaging Het
G6pc C A 11: 101,376,694 Y323* probably null Het
Gm5114 A G 7: 39,409,065 C377R possibly damaging Het
Gm7361 C A 5: 26,261,190 H183Q probably benign Het
Hmbox1 A G 14: 64,896,677 V158A possibly damaging Het
Hmg20a A G 9: 56,488,943 R340G unknown Het
Ifi206 T A 1: 173,482,041 I130F Het
Ifnb1 T C 4: 88,522,674 N34S probably benign Het
Il16 T C 7: 83,674,494 K283E probably damaging Het
Maf T C 8: 115,693,181 D374G probably benign Het
Mettl14 A G 3: 123,374,854 I179T probably benign Het
Mpped1 G A 15: 83,800,050 R91H probably damaging Het
Olfr486 A G 7: 108,171,800 *315Q probably null Het
Phkg1 G A 5: 129,873,268 Q89* probably null Het
Phykpl T A 11: 51,591,458 V133E probably damaging Het
Polr3gl A T 3: 96,579,821 Y183N probably benign Het
Pqlc2 T A 4: 139,306,512 D32V probably damaging Het
Rab13 A G 3: 90,225,533 T187A probably benign Het
Ripor2 A G 13: 24,693,772 M252V probably damaging Het
Sec61a2 T C 2: 5,877,914 N186S probably benign Het
Serpinb5 T C 1: 106,872,389 probably null Het
Serpine3 G A 14: 62,665,027 W29* probably null Het
Sh2b3 T C 5: 121,818,473 R382G probably damaging Het
Slc7a5 A G 8: 121,883,722 L451P probably damaging Het
Slco1a5 T C 6: 142,262,531 probably null Het
Tep1 G A 14: 50,853,590 A695V probably damaging Het
Tnik T C 3: 28,630,594 V857A possibly damaging Het
Trdn A T 10: 33,196,101 M255L probably benign Het
Tsc22d4 G A 5: 137,747,723 S203N probably benign Het
Tsfm T C 10: 127,022,548 E316G possibly damaging Het
Tvp23b T C 11: 62,879,463 probably benign Het
Vgf C A 5: 137,032,245 D420E probably damaging Het
Zan G A 5: 137,464,356 P854S probably benign Het
Zfp831 T C 2: 174,644,023 S164P possibly damaging Het
Other mutations in Nop2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Nop2 APN 6 125133546 missense probably damaging 1.00
IGL00913:Nop2 APN 6 125139821 missense probably damaging 1.00
IGL02568:Nop2 APN 6 125140850 missense probably damaging 1.00
IGL02850:Nop2 APN 6 125144085 missense possibly damaging 0.67
IGL02850:Nop2 APN 6 125144070 missense probably benign 0.01
IGL02851:Nop2 APN 6 125144085 missense possibly damaging 0.67
IGL02851:Nop2 APN 6 125144070 missense probably benign 0.01
IGL03144:Nop2 APN 6 125137512 critical splice donor site probably null
IGL03338:Nop2 APN 6 125139732 splice site probably null
R0211:Nop2 UTSW 6 125141344 missense probably damaging 1.00
R0211:Nop2 UTSW 6 125141344 missense probably damaging 1.00
R0486:Nop2 UTSW 6 125140673 missense probably null 0.14
R0627:Nop2 UTSW 6 125139704 missense possibly damaging 0.90
R1022:Nop2 UTSW 6 125137186 missense probably benign 0.02
R1024:Nop2 UTSW 6 125137186 missense probably benign 0.02
R1068:Nop2 UTSW 6 125132279 missense probably damaging 0.99
R1750:Nop2 UTSW 6 125137638 missense probably benign 0.00
R1847:Nop2 UTSW 6 125137079 unclassified probably benign
R1940:Nop2 UTSW 6 125134634 missense probably benign 0.43
R1972:Nop2 UTSW 6 125134639 missense probably benign 0.02
R2059:Nop2 UTSW 6 125139860 missense probably null 0.95
R2100:Nop2 UTSW 6 125140822 missense probably damaging 1.00
R3123:Nop2 UTSW 6 125132201 utr 5 prime probably benign
R3124:Nop2 UTSW 6 125132201 utr 5 prime probably benign
R3160:Nop2 UTSW 6 125134592 missense probably benign 0.00
R3162:Nop2 UTSW 6 125134592 missense probably benign 0.00
R4521:Nop2 UTSW 6 125133552 missense probably damaging 1.00
R4522:Nop2 UTSW 6 125133552 missense probably damaging 1.00
R4523:Nop2 UTSW 6 125133552 missense probably damaging 1.00
R4524:Nop2 UTSW 6 125133552 missense probably damaging 1.00
R4571:Nop2 UTSW 6 125140881 critical splice donor site probably null
R4695:Nop2 UTSW 6 125144556 missense probably benign 0.00
R4747:Nop2 UTSW 6 125137094 missense probably benign
R5010:Nop2 UTSW 6 125133763 missense probably benign 0.00
R5385:Nop2 UTSW 6 125144361 missense probably benign
R5455:Nop2 UTSW 6 125140643 missense probably benign 0.19
R5567:Nop2 UTSW 6 125133763 missense probably benign 0.00
R5914:Nop2 UTSW 6 125134728 missense probably benign 0.01
R5993:Nop2 UTSW 6 125144019 missense probably benign 0.00
R6031:Nop2 UTSW 6 125133566 critical splice donor site probably null
R6031:Nop2 UTSW 6 125133566 critical splice donor site probably null
R6065:Nop2 UTSW 6 125144565 missense probably benign
R6352:Nop2 UTSW 6 125137207 missense probably benign
R6436:Nop2 UTSW 6 125137311 missense probably benign 0.01
R7393:Nop2 UTSW 6 125133546 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTACCTCAGGAAACTCGGCAG -3'
(R):5'- ATTTCAGAGGGAGTCGGCAC -3'

Sequencing Primer
(F):5'- CTACAGAGCCTGACCTGAAGG -3'
(R):5'- CACAGGAGGTGTTCTCGAGTC -3'
Posted On2019-10-17