Mutagenetix > Incidental Mutations

Incidental Mutation 'R0634:Creb3l2'

58138

Institutional Source

Beutler Lab

Gene Symbol

Creb3l2

Ensembl Gene

ENSMUSG00000038648

Gene Name

cAMP responsive element binding protein 3-like 2

Synonyms

BBF2H7, C530025K05Rik

MMRRC Submission

038823-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.460) question?

Stock #

R0634 (G1)

Quality Score

183

Status

Validated

Chromosome

Chromosomal Location

37327255-37442146 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 37334348 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000040208 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041093]

Predicted Effect

probably benign
Transcript: ENSMUST00000041093

SMART Domains

Protein: ENSMUSP00000040208
Gene: ENSMUSG00000038648

Domain	Start	End	E-Value	Type
low complexity region	203	220	N/A	INTRINSIC
BRLZ	292	356	1.25e-15	SMART
low complexity region	436	452	N/A	INTRINSIC
low complexity region	455	469	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128534

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 99.0%
10x: 97.9%
20x: 96.2%

Validation Efficiency

98% (62/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oasis bZIP transcription factor family. Members of this family can dimerize but form homodimers only. The encoded protein is a transcriptional activator. Translocations between this gene on chromosome 7 and the gene fused in sarcoma on chromosome 16 can be found in some tumors. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit severe chondrodysplasia and die shortly after first birth from suffocation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	G	11: 9,314,491	I2958V	possibly damaging	Het
Adam21	C	A	12: 81,560,352	W212L	probably benign	Het
Adcy2	A	C	13: 68,727,945	H479Q	possibly damaging	Het
Adcy4	T	C	14: 55,781,597	R168G	probably benign	Het
Atp13a2	T	C	4: 141,006,929		probably benign	Het
C1ra	G	A	6: 124,517,505	E304K	possibly damaging	Het
C87977	A	G	4: 144,209,340		probably null	Het
Cc2d2a	A	C	5: 43,681,381		probably benign	Het
Cenpe	T	C	3: 135,246,827	L1426P	probably damaging	Het
Cntn1	A	T	15: 92,314,563	R869*	probably null	Het
Crybg2	G	A	4: 134,075,304		probably benign	Het
Csmd1	A	T	8: 16,226,391	F800I	probably damaging	Het
Dock6	G	A	9: 21,841,527	T330I	probably damaging	Het
Ets2	G	A	16: 95,716,156	E311K	possibly damaging	Het
Fbxo22	A	T	9: 55,214,960	Q141L	probably benign	Het
Fer	C	T	17: 64,035,508	T223M	probably benign	Het
Gm13757	A	T	2: 88,446,617	M107K	probably benign	Het
Gm9774	C	T	3: 92,428,809	W125*	probably null	Het
Gtf3c1	A	T	7: 125,657,477		probably benign	Het
Gtf3c2	G	A	5: 31,159,806	R684*	probably null	Het
Hs6st3	T	A	14: 119,869,062	L294*	probably null	Het
Ighg2c	T	G	12: 113,287,964	E181A	unknown	Het
Igkv6-15	A	T	6: 70,406,779		probably benign	Het
Lrmp	A	T	6: 145,174,628	H523L	probably damaging	Het
Map2k6	C	T	11: 110,494,343	R178*	probably null	Het
Meikin	T	A	11: 54,390,483	D126E	probably benign	Het
Mgst1	A	T	6: 138,156,331	T37S	probably damaging	Het
Mrc2	G	A	11: 105,347,692	V1222M	probably benign	Het
Myom2	C	A	8: 15,119,216		probably benign	Het
Negr1	A	G	3: 157,016,266	K159R	possibly damaging	Het
Nptx1	T	C	11: 119,543,301	T320A	possibly damaging	Het
Olfr490	T	C	7: 108,286,296	I277V	probably benign	Het
Olfr530	A	T	7: 140,373,397	V71E	possibly damaging	Het
Pes1	C	T	11: 3,977,794		probably benign	Het
Pes1	T	G	11: 3,977,795		probably benign	Het
Pkhd1	A	T	1: 20,117,474	Y3537N	probably damaging	Het
Poteg	G	A	8: 27,473,587	G289R	probably benign	Het
Rassf5	T	C	1: 131,244,956	R59G	probably damaging	Het
Reln	A	T	5: 22,018,869	W961R	probably damaging	Het
Rhot2	G	A	17: 25,842,028	H168Y	possibly damaging	Het
Ripk3	G	T	14: 55,788,391		probably benign	Het
Samm50	A	G	15: 84,214,171		silent	Het
Sap30bp	T	C	11: 115,957,403	I117T	probably damaging	Het
Sephs1	A	G	2: 4,899,560	T250A	probably benign	Het
Sipa1l2	A	T	8: 125,422,624	L1632*	probably null	Het
Sirt7	T	C	11: 120,622,129		probably benign	Het
Smg8	T	C	11: 87,086,108	T216A	possibly damaging	Het
Sox9	A	G	11: 112,784,942	Y319C	probably damaging	Het
Sspn	G	A	6: 145,961,151	A27T	possibly damaging	Het
Suco	A	G	1: 161,838,804	V509A	possibly damaging	Het
Svep1	C	T	4: 58,070,661	C2375Y	possibly damaging	Het
Trbv21	T	A	6: 41,203,050		probably benign	Het
Uimc1	C	T	13: 55,060,266	E455K	possibly damaging	Het
Upk3b	A	G	5: 136,040,076	T100A	possibly damaging	Het
Usp47	A	G	7: 112,108,655	N1303D	probably damaging	Het
Vav1	A	T	17: 57,303,862	D476V	probably benign	Het
Vmn1r68	A	G	7: 10,527,235	V312A	probably benign	Het
Wdr62	A	G	7: 30,270,174	V287A	probably damaging	Het
Zcchc4	C	T	5: 52,783,208	P40S	probably benign	Het
Zfp326	T	A	5: 105,886,203	Y26*	probably null	Het
Zfp592	A	G	7: 81,038,071	H915R	probably damaging	Het

Other mutations in Creb3l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01129:Creb3l2	APN	6	37353634	splice site	probably benign
R0611:Creb3l2	UTSW	6	37334481	missense	probably benign	0.01
R3755:Creb3l2	UTSW	6	37364026	missense	possibly damaging	0.86
R3808:Creb3l2	UTSW	6	37355690	missense	probably damaging	0.96
R4060:Creb3l2	UTSW	6	37334549	missense	probably benign	0.32
R4771:Creb3l2	UTSW	6	37334577	missense	probably benign	0.26
R6031:Creb3l2	UTSW	6	37334434	missense	probably benign	0.01
R6031:Creb3l2	UTSW	6	37334434	missense	probably benign	0.01
R7051:Creb3l2	UTSW	6	37336265	missense	possibly damaging	0.77
R7381:Creb3l2	UTSW	6	37335848	missense	probably damaging	1.00
R7491:Creb3l2	UTSW	6	37379859	missense	probably benign	0.01
R7868:Creb3l2	UTSW	6	37335869	missense	probably damaging	0.99
R7951:Creb3l2	UTSW	6	37335869	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ATACTGACTGAGGCGGCTCACATC -3'
(R):5'- ATCTATGAGGAACACGCTCCCCTG -3'

Sequencing Primer
(F):5'- TTGGGATCATCACTGCCAGC -3'
(R):5'- AAGAGTCGTCGAGCCCAG -3'

Posted On

2013-07-11