Incidental Mutation 'R0634:Creb3l2'
ID58138
Institutional Source Beutler Lab
Gene Symbol Creb3l2
Ensembl Gene ENSMUSG00000038648
Gene NamecAMP responsive element binding protein 3-like 2
SynonymsBBF2H7, C530025K05Rik
MMRRC Submission 038823-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.526) question?
Stock #R0634 (G1)
Quality Score183
Status Validated
Chromosome6
Chromosomal Location37327255-37442146 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 37334348 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000040208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041093]
Predicted Effect probably benign
Transcript: ENSMUST00000041093
SMART Domains Protein: ENSMUSP00000040208
Gene: ENSMUSG00000038648

DomainStartEndE-ValueType
low complexity region 203 220 N/A INTRINSIC
BRLZ 292 356 1.25e-15 SMART
low complexity region 436 452 N/A INTRINSIC
low complexity region 455 469 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128534
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.2%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oasis bZIP transcription factor family. Members of this family can dimerize but form homodimers only. The encoded protein is a transcriptional activator. Translocations between this gene on chromosome 7 and the gene fused in sarcoma on chromosome 16 can be found in some tumors. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit severe chondrodysplasia and die shortly after first birth from suffocation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,314,491 I2958V possibly damaging Het
Adam21 C A 12: 81,560,352 W212L probably benign Het
Adcy2 A C 13: 68,727,945 H479Q possibly damaging Het
Adcy4 T C 14: 55,781,597 R168G probably benign Het
Atp13a2 T C 4: 141,006,929 probably benign Het
C1ra G A 6: 124,517,505 E304K possibly damaging Het
C87977 A G 4: 144,209,340 probably null Het
Cc2d2a A C 5: 43,681,381 probably benign Het
Cenpe T C 3: 135,246,827 L1426P probably damaging Het
Cntn1 A T 15: 92,314,563 R869* probably null Het
Crybg2 G A 4: 134,075,304 probably benign Het
Csmd1 A T 8: 16,226,391 F800I probably damaging Het
Dock6 G A 9: 21,841,527 T330I probably damaging Het
Ets2 G A 16: 95,716,156 E311K possibly damaging Het
Fbxo22 A T 9: 55,214,960 Q141L probably benign Het
Fer C T 17: 64,035,508 T223M probably benign Het
Gm13757 A T 2: 88,446,617 M107K probably benign Het
Gm9774 C T 3: 92,428,809 W125* probably null Het
Gtf3c1 A T 7: 125,657,477 probably benign Het
Gtf3c2 G A 5: 31,159,806 R684* probably null Het
Hs6st3 T A 14: 119,869,062 L294* probably null Het
Ighg2c T G 12: 113,287,964 E181A unknown Het
Igkv6-15 A T 6: 70,406,779 probably benign Het
Lrmp A T 6: 145,174,628 H523L probably damaging Het
Map2k6 C T 11: 110,494,343 R178* probably null Het
Meikin T A 11: 54,390,483 D126E probably benign Het
Mgst1 A T 6: 138,156,331 T37S probably damaging Het
Mrc2 G A 11: 105,347,692 V1222M probably benign Het
Myom2 C A 8: 15,119,216 probably benign Het
Negr1 A G 3: 157,016,266 K159R possibly damaging Het
Nptx1 T C 11: 119,543,301 T320A possibly damaging Het
Olfr490 T C 7: 108,286,296 I277V probably benign Het
Olfr530 A T 7: 140,373,397 V71E possibly damaging Het
Pes1 C T 11: 3,977,794 probably benign Het
Pes1 T G 11: 3,977,795 probably benign Het
Pkhd1 A T 1: 20,117,474 Y3537N probably damaging Het
Poteg G A 8: 27,473,587 G289R probably benign Het
Rassf5 T C 1: 131,244,956 R59G probably damaging Het
Reln A T 5: 22,018,869 W961R probably damaging Het
Rhot2 G A 17: 25,842,028 H168Y possibly damaging Het
Ripk3 G T 14: 55,788,391 probably benign Het
Samm50 A G 15: 84,214,171 silent Het
Sap30bp T C 11: 115,957,403 I117T probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Sipa1l2 A T 8: 125,422,624 L1632* probably null Het
Sirt7 T C 11: 120,622,129 probably benign Het
Smg8 T C 11: 87,086,108 T216A possibly damaging Het
Sox9 A G 11: 112,784,942 Y319C probably damaging Het
Sspn G A 6: 145,961,151 A27T possibly damaging Het
Suco A G 1: 161,838,804 V509A possibly damaging Het
Svep1 C T 4: 58,070,661 C2375Y possibly damaging Het
Trbv21 T A 6: 41,203,050 probably benign Het
Uimc1 C T 13: 55,060,266 E455K possibly damaging Het
Upk3b A G 5: 136,040,076 T100A possibly damaging Het
Usp47 A G 7: 112,108,655 N1303D probably damaging Het
Vav1 A T 17: 57,303,862 D476V probably benign Het
Vmn1r68 A G 7: 10,527,235 V312A probably benign Het
Wdr62 A G 7: 30,270,174 V287A probably damaging Het
Zcchc4 C T 5: 52,783,208 P40S probably benign Het
Zfp326 T A 5: 105,886,203 Y26* probably null Het
Zfp592 A G 7: 81,038,071 H915R probably damaging Het
Other mutations in Creb3l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Creb3l2 APN 6 37353634 splice site probably benign
R0611:Creb3l2 UTSW 6 37334481 missense probably benign 0.01
R3755:Creb3l2 UTSW 6 37364026 missense possibly damaging 0.86
R3808:Creb3l2 UTSW 6 37355690 missense probably damaging 0.96
R4060:Creb3l2 UTSW 6 37334549 missense probably benign 0.32
R4771:Creb3l2 UTSW 6 37334577 missense probably benign 0.26
R6031:Creb3l2 UTSW 6 37334434 missense probably benign 0.01
R6031:Creb3l2 UTSW 6 37334434 missense probably benign 0.01
R7051:Creb3l2 UTSW 6 37336265 missense possibly damaging 0.77
R7381:Creb3l2 UTSW 6 37335848 missense probably damaging 1.00
R7491:Creb3l2 UTSW 6 37379859 missense probably benign 0.01
R7868:Creb3l2 UTSW 6 37335869 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATACTGACTGAGGCGGCTCACATC -3'
(R):5'- ATCTATGAGGAACACGCTCCCCTG -3'

Sequencing Primer
(F):5'- TTGGGATCATCACTGCCAGC -3'
(R):5'- AAGAGTCGTCGAGCCCAG -3'
Posted On2013-07-11