Incidental Mutation 'R7499:Olfr486'
ID 581380
Institutional Source Beutler Lab
Gene Symbol Olfr486
Ensembl Gene ENSMUSG00000096068
Gene Name olfactory receptor 486
Synonyms MOR204-19, GA_x6K02T2PBJ9-10501920-10500976
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock # R7499 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 108171798-108172742 bp(-) (GRCm38)
Type of Mutation makesense
DNA Base Change (assembly) A to G at 108171800 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Stop codon to Glutamine at position 315 (*315Q)
Ref Sequence ENSEMBL: ENSMUSP00000071918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072035]
AlphaFold Q8VFD0
Predicted Effect probably null
Transcript: ENSMUST00000072035
AA Change: *315Q
SMART Domains Protein: ENSMUSP00000071918
Gene: ENSMUSG00000096068
AA Change: *315Q

DomainStartEndE-ValueType
Pfam:7tm_4 31 311 6.8e-51 PFAM
Pfam:7tm_1 44 293 6.6e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T A 9: 55,999,902 D180V possibly damaging Het
Abat T C 16: 8,603,754 probably null Het
Ankfn1 G A 11: 89,391,750 T357I probably benign Het
Armc3 C T 2: 19,285,979 T423I probably benign Het
Asb6 T C 2: 30,824,460 T213A possibly damaging Het
Atp11a T C 8: 12,832,575 C488R probably benign Het
Bag6 G A 17: 35,144,392 R736H probably benign Het
Bche G A 3: 73,701,898 P65L probably damaging Het
Cela3a T A 4: 137,405,639 I101F probably damaging Het
Cep170 A T 1: 176,774,462 D359E probably damaging Het
Chfr T C 5: 110,151,683 V314A probably benign Het
Clpb T C 7: 101,722,728 F224L possibly damaging Het
Coro2a T C 4: 46,539,188 K527R probably benign Het
Cpa5 A G 6: 30,630,857 T373A possibly damaging Het
Ctsd A T 7: 142,383,412 probably null Het
Dlx5 G A 6: 6,878,340 S230F possibly damaging Het
Dlx5 A C 6: 6,878,341 S230A probably benign Het
Dmc1 G T 15: 79,602,420 S11* probably null Het
Dnah1 G A 14: 31,315,122 Q256* probably null Het
Dnah3 A G 7: 120,060,912 F846L probably damaging Het
Dnah5 A T 15: 28,302,450 I1618F probably damaging Het
Emsy A G 7: 98,630,331 V267A possibly damaging Het
Fgfr3 GGACCTCTCCGTG GG 5: 33,735,422 probably null Het
Frem1 T C 4: 83,005,770 I317M probably damaging Het
G6pc C A 11: 101,376,694 Y323* probably null Het
Gm5114 A G 7: 39,409,065 C377R possibly damaging Het
Gm7361 C A 5: 26,261,190 H183Q probably benign Het
Hmbox1 A G 14: 64,896,677 V158A possibly damaging Het
Hmg20a A G 9: 56,488,943 R340G unknown Het
Ifi206 T A 1: 173,482,041 I130F Het
Ifnb1 T C 4: 88,522,674 N34S probably benign Het
Il16 T C 7: 83,674,494 K283E probably damaging Het
Maf T C 8: 115,693,181 D374G probably benign Het
Mettl14 A G 3: 123,374,854 I179T probably benign Het
Mpped1 G A 15: 83,800,050 R91H probably damaging Het
Nop2 C A 6: 125,144,208 P651Q possibly damaging Het
Phkg1 G A 5: 129,873,268 Q89* probably null Het
Phykpl T A 11: 51,591,458 V133E probably damaging Het
Polr3gl A T 3: 96,579,821 Y183N probably benign Het
Pqlc2 T A 4: 139,306,512 D32V probably damaging Het
Rab13 A G 3: 90,225,533 T187A probably benign Het
Ripor2 A G 13: 24,693,772 M252V probably damaging Het
Sec61a2 T C 2: 5,877,914 N186S probably benign Het
Serpinb5 T C 1: 106,872,389 probably null Het
Serpine3 G A 14: 62,665,027 W29* probably null Het
Sh2b3 T C 5: 121,818,473 R382G probably damaging Het
Slc7a5 A G 8: 121,883,722 L451P probably damaging Het
Slco1a5 T C 6: 142,262,531 probably null Het
Tep1 G A 14: 50,853,590 A695V probably damaging Het
Tnik T C 3: 28,630,594 V857A possibly damaging Het
Trdn A T 10: 33,196,101 M255L probably benign Het
Tsc22d4 G A 5: 137,747,723 S203N probably benign Het
Tsfm T C 10: 127,022,548 E316G possibly damaging Het
Tvp23b T C 11: 62,879,463 probably benign Het
Vgf C A 5: 137,032,245 D420E probably damaging Het
Zan G A 5: 137,464,356 P854S probably benign Het
Zfp831 T C 2: 174,644,023 S164P possibly damaging Het
Other mutations in Olfr486
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0033:Olfr486 UTSW 7 108171927 missense probably benign 0.09
R0144:Olfr486 UTSW 7 108171971 missense probably benign 0.00
R0165:Olfr486 UTSW 7 108172675 missense probably benign 0.03
R0739:Olfr486 UTSW 7 108172010 missense probably benign 0.00
R1027:Olfr486 UTSW 7 108172141 missense probably damaging 0.98
R1781:Olfr486 UTSW 7 108171883 missense probably benign 0.06
R3729:Olfr486 UTSW 7 108172309 missense probably benign 0.13
R4505:Olfr486 UTSW 7 108171968 missense probably benign 0.00
R5223:Olfr486 UTSW 7 108172708 missense probably benign 0.20
R7089:Olfr486 UTSW 7 108172494 missense probably benign 0.01
R7894:Olfr486 UTSW 7 108172184 missense probably benign
R7995:Olfr486 UTSW 7 108172000 missense probably damaging 1.00
R8807:Olfr486 UTSW 7 108172645 missense possibly damaging 0.93
R9050:Olfr486 UTSW 7 108171880 missense probably damaging 1.00
R9244:Olfr486 UTSW 7 108172645 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TACAAGCCTGAGCAGAGCTG -3'
(R):5'- TACTGCAGTCACTCTCTACTATGG -3'

Sequencing Primer
(F):5'- CTATTAGGTTCAGGAAGGTACATTTG -3'
(R):5'- CAGTCACTCTCTACTATGGAACTATC -3'
Posted On 2019-10-17