Incidental Mutation 'R7499:Tsfm'
ID581388
Institutional Source Beutler Lab
Gene Symbol Tsfm
Ensembl Gene ENSMUSG00000040521
Gene NameTs translation elongation factor, mitochondrial
SynonymsEF-TS, 9430024O13Rik, 2310050B20Rik, EF-Tsmt
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7499 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location127011572-127030840 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127022548 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 316 (E316G)
Ref Sequence ENSEMBL: ENSMUSP00000042134 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026500] [ENSMUST00000040560] [ENSMUST00000120547] [ENSMUST00000129173] [ENSMUST00000152054]
Predicted Effect probably benign
Transcript: ENSMUST00000026500
SMART Domains Protein: ENSMUSP00000026500
Gene: ENSMUSG00000025432

DomainStartEndE-ValueType
GEL 14 111 9.44e-24 SMART
GEL 132 226 8.89e-20 SMART
GEL 253 346 1.19e-29 SMART
GEL 395 492 2.07e-29 SMART
GEL 512 598 4.01e-27 SMART
GEL 617 711 2.81e-31 SMART
VHP 784 819 1.31e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000040560
AA Change: E316G

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000042134
Gene: ENSMUSG00000040521
AA Change: E316G

DomainStartEndE-ValueType
low complexity region 38 52 N/A INTRINSIC
Pfam:EF_TS 115 273 9.6e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120547
SMART Domains Protein: ENSMUSP00000113446
Gene: ENSMUSG00000040521

DomainStartEndE-ValueType
Pfam:UBA 44 81 3.4e-10 PFAM
Pfam:EF_TS 101 192 1.3e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129173
SMART Domains Protein: ENSMUSP00000123405
Gene: ENSMUSG00000025432

DomainStartEndE-ValueType
GEL 14 111 9.44e-24 SMART
GEL 132 226 8.89e-20 SMART
GEL 253 346 1.19e-29 SMART
GEL 395 492 2.07e-29 SMART
GEL 512 598 4.01e-27 SMART
GEL 617 711 2.81e-31 SMART
VHP 784 819 1.31e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152054
SMART Domains Protein: ENSMUSP00000122669
Gene: ENSMUSG00000040521

DomainStartEndE-ValueType
Pfam:UBA 44 81 1.2e-10 PFAM
SCOP:d1efub4 101 120 5e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial translation elongation factor. The encoded protein is an enzyme that catalyzes the exchange of guanine nucleotides on the translation elongation factor Tu during the elongation step of mitchondrial protein translation. Mutations in this gene are associated with combined oxidative phosphorylation deficiency-3 syndrome. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T A 9: 55,999,902 D180V possibly damaging Het
Abat T C 16: 8,603,754 probably null Het
Ankfn1 G A 11: 89,391,750 T357I probably benign Het
Armc3 C T 2: 19,285,979 T423I probably benign Het
Asb6 T C 2: 30,824,460 T213A possibly damaging Het
Atp11a T C 8: 12,832,575 C488R probably benign Het
Bag6 G A 17: 35,144,392 R736H probably benign Het
Bche G A 3: 73,701,898 P65L probably damaging Het
Cela3a T A 4: 137,405,639 I101F probably damaging Het
Cep170 A T 1: 176,774,462 D359E probably damaging Het
Chfr T C 5: 110,151,683 V314A probably benign Het
Clpb T C 7: 101,722,728 F224L possibly damaging Het
Coro2a T C 4: 46,539,188 K527R probably benign Het
Cpa5 A G 6: 30,630,857 T373A possibly damaging Het
Ctsd A T 7: 142,383,412 probably null Het
Dlx5 G A 6: 6,878,340 S230F possibly damaging Het
Dlx5 A C 6: 6,878,341 S230A probably benign Het
Dmc1 G T 15: 79,602,420 S11* probably null Het
Dnah1 G A 14: 31,315,122 Q256* probably null Het
Dnah3 A G 7: 120,060,912 F846L probably damaging Het
Dnah5 A T 15: 28,302,450 I1618F probably damaging Het
Emsy A G 7: 98,630,331 V267A possibly damaging Het
Fgfr3 GGACCTCTCCGTG GG 5: 33,735,422 probably null Het
Frem1 T C 4: 83,005,770 I317M probably damaging Het
G6pc C A 11: 101,376,694 Y323* probably null Het
Gm5114 A G 7: 39,409,065 C377R possibly damaging Het
Gm7361 C A 5: 26,261,190 H183Q probably benign Het
Hmbox1 A G 14: 64,896,677 V158A possibly damaging Het
Hmg20a A G 9: 56,488,943 R340G unknown Het
Ifi206 T A 1: 173,482,041 I130F Het
Ifnb1 T C 4: 88,522,674 N34S probably benign Het
Il16 T C 7: 83,674,494 K283E probably damaging Het
Maf T C 8: 115,693,181 D374G probably benign Het
Mettl14 A G 3: 123,374,854 I179T probably benign Het
Mpped1 G A 15: 83,800,050 R91H probably damaging Het
Nop2 C A 6: 125,144,208 P651Q possibly damaging Het
Olfr486 A G 7: 108,171,800 *315Q probably null Het
Phkg1 G A 5: 129,873,268 Q89* probably null Het
Phykpl T A 11: 51,591,458 V133E probably damaging Het
Polr3gl A T 3: 96,579,821 Y183N probably benign Het
Pqlc2 T A 4: 139,306,512 D32V probably damaging Het
Rab13 A G 3: 90,225,533 T187A probably benign Het
Ripor2 A G 13: 24,693,772 M252V probably damaging Het
Sec61a2 T C 2: 5,877,914 N186S probably benign Het
Serpinb5 T C 1: 106,872,389 probably null Het
Serpine3 G A 14: 62,665,027 W29* probably null Het
Sh2b3 T C 5: 121,818,473 R382G probably damaging Het
Slc7a5 A G 8: 121,883,722 L451P probably damaging Het
Slco1a5 T C 6: 142,262,531 probably null Het
Tep1 G A 14: 50,853,590 A695V probably damaging Het
Tnik T C 3: 28,630,594 V857A possibly damaging Het
Trdn A T 10: 33,196,101 M255L probably benign Het
Tsc22d4 G A 5: 137,747,723 S203N probably benign Het
Tvp23b T C 11: 62,879,463 probably benign Het
Vgf C A 5: 137,032,245 D420E probably damaging Het
Zan G A 5: 137,464,356 P854S probably benign Het
Zfp831 T C 2: 174,644,023 S164P possibly damaging Het
Other mutations in Tsfm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00678:Tsfm APN 10 127028442 nonsense probably null
IGL00910:Tsfm APN 10 127028359 intron probably benign
IGL01553:Tsfm APN 10 127028390 missense probably benign 0.01
R0123:Tsfm UTSW 10 127022929 intron probably benign
R0129:Tsfm UTSW 10 127030470 missense probably benign 0.28
R0134:Tsfm UTSW 10 127022929 intron probably benign
R1689:Tsfm UTSW 10 127028455 missense probably damaging 1.00
R2004:Tsfm UTSW 10 127030794 missense probably damaging 1.00
R2144:Tsfm UTSW 10 127028445 nonsense probably null
R4574:Tsfm UTSW 10 127028373 missense probably damaging 0.99
R4690:Tsfm UTSW 10 127030678 intron probably benign
R5141:Tsfm UTSW 10 127029613 missense probably damaging 0.98
R5371:Tsfm UTSW 10 127011643 missense probably benign 0.03
R5801:Tsfm UTSW 10 127022837 frame shift probably null
R5949:Tsfm UTSW 10 127028375 missense probably damaging 1.00
R6959:Tsfm UTSW 10 127022909 missense probably benign 0.05
R7248:Tsfm UTSW 10 127011631 missense probably benign 0.31
R7810:Tsfm UTSW 10 127011689 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TACAAAGCCTGGCATGTGTG -3'
(R):5'- AGCAGATCGCAAACCTGGAG -3'

Sequencing Primer
(F):5'- CACACTCACACATTAAGCACTATAC -3'
(R):5'- CTTGGGGCAGCACGTGG -3'
Posted On2019-10-17