Incidental Mutation 'R7499:G6pc'
ID581392
Institutional Source Beutler Lab
Gene Symbol G6pc
Ensembl Gene ENSMUSG00000078650
Gene Nameglucose-6-phosphatase, catalytic
SynonymsGlc-6-Pase, G6Pase, G6pt, Glc-6-Pase-alpha
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7499 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location101367561-101377903 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 101376694 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 323 (Y323*)
Ref Sequence ENSEMBL: ENSMUSP00000019469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019469]
Predicted Effect probably null
Transcript: ENSMUST00000019469
AA Change: Y323*
SMART Domains Protein: ENSMUSP00000019469
Gene: ENSMUSG00000078650
AA Change: Y323*

DomainStartEndE-ValueType
acidPPc 56 196 2.28e-40 SMART
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 256 278 N/A INTRINSIC
transmembrane domain 291 308 N/A INTRINSIC
transmembrane domain 323 345 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: The enzyme encoded by this gene is a multisubunit integral membrane protein of the endoplasmic reticulum that is composed of a catalytic subunit and transporters for glucose-6-phosphate, inorganic phosphate, and glucose. This gene is one of three glucose-6-phosphatase catalytic-subunit-encoding genes in mouse. Glucose-6-phosphatase catalyzes the hydrolysis of D-glucose 6-phosphate to D-glucose and orthophosphate and is a key enzyme in glucose homeostasis, functioning in gluconeogenesis and glycogenolysis. Mutations in this gene cause glycogen storage disease type I (GSD1). [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene tend to die within a couple of weeks of weaning. Blood chemistry and glucose metabolism are abnormal as is glycogen storage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T A 9: 55,999,902 D180V possibly damaging Het
Abat T C 16: 8,603,754 probably null Het
Ankfn1 G A 11: 89,391,750 T357I probably benign Het
Armc3 C T 2: 19,285,979 T423I probably benign Het
Asb6 T C 2: 30,824,460 T213A possibly damaging Het
Atp11a T C 8: 12,832,575 C488R probably benign Het
Bag6 G A 17: 35,144,392 R736H probably benign Het
Bche G A 3: 73,701,898 P65L probably damaging Het
Cela3a T A 4: 137,405,639 I101F probably damaging Het
Cep170 A T 1: 176,774,462 D359E probably damaging Het
Chfr T C 5: 110,151,683 V314A probably benign Het
Clpb T C 7: 101,722,728 F224L possibly damaging Het
Coro2a T C 4: 46,539,188 K527R probably benign Het
Cpa5 A G 6: 30,630,857 T373A possibly damaging Het
Ctsd A T 7: 142,383,412 probably null Het
Dlx5 G A 6: 6,878,340 S230F possibly damaging Het
Dlx5 A C 6: 6,878,341 S230A probably benign Het
Dmc1 G T 15: 79,602,420 S11* probably null Het
Dnah1 G A 14: 31,315,122 Q256* probably null Het
Dnah3 A G 7: 120,060,912 F846L probably damaging Het
Dnah5 A T 15: 28,302,450 I1618F probably damaging Het
Emsy A G 7: 98,630,331 V267A possibly damaging Het
Fgfr3 GGACCTCTCCGTG GG 5: 33,735,422 probably null Het
Frem1 T C 4: 83,005,770 I317M probably damaging Het
Gm5114 A G 7: 39,409,065 C377R possibly damaging Het
Gm7361 C A 5: 26,261,190 H183Q probably benign Het
Hmbox1 A G 14: 64,896,677 V158A possibly damaging Het
Hmg20a A G 9: 56,488,943 R340G unknown Het
Ifi206 T A 1: 173,482,041 I130F Het
Ifnb1 T C 4: 88,522,674 N34S probably benign Het
Il16 T C 7: 83,674,494 K283E probably damaging Het
Maf T C 8: 115,693,181 D374G probably benign Het
Mettl14 A G 3: 123,374,854 I179T probably benign Het
Mpped1 G A 15: 83,800,050 R91H probably damaging Het
Nop2 C A 6: 125,144,208 P651Q possibly damaging Het
Olfr486 A G 7: 108,171,800 *315Q probably null Het
Phkg1 G A 5: 129,873,268 Q89* probably null Het
Phykpl T A 11: 51,591,458 V133E probably damaging Het
Polr3gl A T 3: 96,579,821 Y183N probably benign Het
Pqlc2 T A 4: 139,306,512 D32V probably damaging Het
Rab13 A G 3: 90,225,533 T187A probably benign Het
Ripor2 A G 13: 24,693,772 M252V probably damaging Het
Sec61a2 T C 2: 5,877,914 N186S probably benign Het
Serpinb5 T C 1: 106,872,389 probably null Het
Serpine3 G A 14: 62,665,027 W29* probably null Het
Sh2b3 T C 5: 121,818,473 R382G probably damaging Het
Slc7a5 A G 8: 121,883,722 L451P probably damaging Het
Slco1a5 T C 6: 142,262,531 probably null Het
Tep1 G A 14: 50,853,590 A695V probably damaging Het
Tnik T C 3: 28,630,594 V857A possibly damaging Het
Trdn A T 10: 33,196,101 M255L probably benign Het
Tsc22d4 G A 5: 137,747,723 S203N probably benign Het
Tsfm T C 10: 127,022,548 E316G possibly damaging Het
Tvp23b T C 11: 62,879,463 probably benign Het
Vgf C A 5: 137,032,245 D420E probably damaging Het
Zan G A 5: 137,464,356 P854S probably benign Het
Zfp831 T C 2: 174,644,023 S164P possibly damaging Het
Other mutations in G6pc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:G6pc APN 11 101370723 missense probably damaging 1.00
IGL03068:G6pc APN 11 101370750 missense probably benign 0.01
R1988:G6pc UTSW 11 101367942 missense probably damaging 0.97
R3936:G6pc UTSW 11 101374603 missense probably benign
R4601:G6pc UTSW 11 101372741 missense probably damaging 1.00
R4677:G6pc UTSW 11 101376613 missense probably benign
R6073:G6pc UTSW 11 101367976 missense probably benign
R6304:G6pc UTSW 11 101367909 missense probably damaging 1.00
R7103:G6pc UTSW 11 101374587 splice site probably null
R7143:G6pc UTSW 11 101370723 missense probably damaging 1.00
R7438:G6pc UTSW 11 101376677 missense probably benign 0.17
R7960:G6pc UTSW 11 101376533 missense probably damaging 1.00
R8339:G6pc UTSW 11 101376488 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TTGACACTACACCCTTTGCCAG -3'
(R):5'- GCCTCACAATGGGTTTCAGAG -3'

Sequencing Primer
(F):5'- AGCCTCTTCAAAAACCTGGG -3'
(R):5'- CTCACAATGGGTTTCAGAGGCTTTAG -3'
Posted On2019-10-17