Incidental Mutation 'R7499:Ripor2'
ID581393
Institutional Source Beutler Lab
Gene Symbol Ripor2
Ensembl Gene ENSMUSG00000036006
Gene NameRHO family interacting cell polarization regulator 2
Synonyms6330500D04Rik, E430013J17Rik, Fam65b, 1700108N18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock #R7499 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location24582189-24733816 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24693772 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 252 (M252V)
Ref Sequence ENSEMBL: ENSMUSP00000106013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038477] [ENSMUST00000058009] [ENSMUST00000091694] [ENSMUST00000110383] [ENSMUST00000110384] [ENSMUST00000132689]
Predicted Effect probably damaging
Transcript: ENSMUST00000038477
AA Change: M252V

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000043663
Gene: ENSMUSG00000036006
AA Change: M252V

DomainStartEndE-ValueType
coiled coil region 108 137 N/A INTRINSIC
low complexity region 461 476 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000058009
AA Change: M252V

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000051342
Gene: ENSMUSG00000036006
AA Change: M252V

DomainStartEndE-ValueType
coiled coil region 108 137 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000091694
AA Change: M255V

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000089286
Gene: ENSMUSG00000036006
AA Change: M255V

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
coiled coil region 111 140 N/A INTRINSIC
low complexity region 422 437 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110383
AA Change: M227V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106012
Gene: ENSMUSG00000036006
AA Change: M227V

DomainStartEndE-ValueType
coiled coil region 83 112 N/A INTRINSIC
low complexity region 436 451 N/A INTRINSIC
low complexity region 630 639 N/A INTRINSIC
low complexity region 657 672 N/A INTRINSIC
low complexity region 857 864 N/A INTRINSIC
SCOP:d1gw5a_ 901 1023 2e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110384
AA Change: M252V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106013
Gene: ENSMUSG00000036006
AA Change: M252V

DomainStartEndE-ValueType
Pfam:PL48 41 389 6e-174 PFAM
low complexity region 461 476 N/A INTRINSIC
low complexity region 655 664 N/A INTRINSIC
low complexity region 682 697 N/A INTRINSIC
low complexity region 882 889 N/A INTRINSIC
SCOP:d1gw5a_ 926 1048 2e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132689
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an atypical inhibitor of the small G protein RhoA. Inhibition of RhoA activity by the encoded protein mediates myoblast fusion and polarization of T cells and neutrophils. The encoded protein is a component of hair cell stereocilia that is essential for hearing. A splice site mutation in this gene results in hearing loss in human patients. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous knockout mice are deaf. The gene product is expressed in the basal region of cochlear hair cell stereocillia, which are disorganized and malformed in null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T A 9: 55,999,902 D180V possibly damaging Het
Abat T C 16: 8,603,754 probably null Het
Ankfn1 G A 11: 89,391,750 T357I probably benign Het
Armc3 C T 2: 19,285,979 T423I probably benign Het
Asb6 T C 2: 30,824,460 T213A possibly damaging Het
Atp11a T C 8: 12,832,575 C488R probably benign Het
Bag6 G A 17: 35,144,392 R736H probably benign Het
Bche G A 3: 73,701,898 P65L probably damaging Het
Cela3a T A 4: 137,405,639 I101F probably damaging Het
Cep170 A T 1: 176,774,462 D359E probably damaging Het
Chfr T C 5: 110,151,683 V314A probably benign Het
Clpb T C 7: 101,722,728 F224L possibly damaging Het
Coro2a T C 4: 46,539,188 K527R probably benign Het
Cpa5 A G 6: 30,630,857 T373A possibly damaging Het
Ctsd A T 7: 142,383,412 probably null Het
Dlx5 G A 6: 6,878,340 S230F possibly damaging Het
Dlx5 A C 6: 6,878,341 S230A probably benign Het
Dmc1 G T 15: 79,602,420 S11* probably null Het
Dnah1 G A 14: 31,315,122 Q256* probably null Het
Dnah3 A G 7: 120,060,912 F846L probably damaging Het
Dnah5 A T 15: 28,302,450 I1618F probably damaging Het
Emsy A G 7: 98,630,331 V267A possibly damaging Het
Fgfr3 GGACCTCTCCGTG GG 5: 33,735,422 probably null Het
Frem1 T C 4: 83,005,770 I317M probably damaging Het
G6pc C A 11: 101,376,694 Y323* probably null Het
Gm5114 A G 7: 39,409,065 C377R possibly damaging Het
Gm7361 C A 5: 26,261,190 H183Q probably benign Het
Hmbox1 A G 14: 64,896,677 V158A possibly damaging Het
Hmg20a A G 9: 56,488,943 R340G unknown Het
Ifi206 T A 1: 173,482,041 I130F Het
Ifnb1 T C 4: 88,522,674 N34S probably benign Het
Il16 T C 7: 83,674,494 K283E probably damaging Het
Maf T C 8: 115,693,181 D374G probably benign Het
Mettl14 A G 3: 123,374,854 I179T probably benign Het
Mpped1 G A 15: 83,800,050 R91H probably damaging Het
Nop2 C A 6: 125,144,208 P651Q possibly damaging Het
Olfr486 A G 7: 108,171,800 *315Q probably null Het
Phkg1 G A 5: 129,873,268 Q89* probably null Het
Phykpl T A 11: 51,591,458 V133E probably damaging Het
Polr3gl A T 3: 96,579,821 Y183N probably benign Het
Pqlc2 T A 4: 139,306,512 D32V probably damaging Het
Rab13 A G 3: 90,225,533 T187A probably benign Het
Sec61a2 T C 2: 5,877,914 N186S probably benign Het
Serpinb5 T C 1: 106,872,389 probably null Het
Serpine3 G A 14: 62,665,027 W29* probably null Het
Sh2b3 T C 5: 121,818,473 R382G probably damaging Het
Slc7a5 A G 8: 121,883,722 L451P probably damaging Het
Slco1a5 T C 6: 142,262,531 probably null Het
Tep1 G A 14: 50,853,590 A695V probably damaging Het
Tnik T C 3: 28,630,594 V857A possibly damaging Het
Trdn A T 10: 33,196,101 M255L probably benign Het
Tsc22d4 G A 5: 137,747,723 S203N probably benign Het
Tsfm T C 10: 127,022,548 E316G possibly damaging Het
Tvp23b T C 11: 62,879,463 probably benign Het
Vgf C A 5: 137,032,245 D420E probably damaging Het
Zan G A 5: 137,464,356 P854S probably benign Het
Zfp831 T C 2: 174,644,023 S164P possibly damaging Het
Other mutations in Ripor2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Ripor2 APN 13 24701207 missense probably benign 0.11
IGL02145:Ripor2 APN 13 24717571 missense probably damaging 1.00
IGL02351:Ripor2 APN 13 24731589 missense probably damaging 1.00
IGL02358:Ripor2 APN 13 24731589 missense probably damaging 1.00
IGL02377:Ripor2 APN 13 24695566 splice site probably benign
IGL02533:Ripor2 APN 13 24701395 nonsense probably null
IGL02798:Ripor2 APN 13 24674666 missense probably damaging 0.99
IGL02852:Ripor2 APN 13 24695698 missense probably damaging 1.00
IGL02869:Ripor2 APN 13 24696529 missense possibly damaging 0.46
IGL03219:Ripor2 APN 13 24723719 missense probably damaging 1.00
gentleman UTSW 13 24694145 missense probably damaging 1.00
Jack UTSW 13 24677841 nonsense probably null
whitechapel UTSW 13 24673112 critical splice donor site probably null
R0045:Ripor2 UTSW 13 24694226 missense probably damaging 1.00
R0101:Ripor2 UTSW 13 24680632 missense probably damaging 1.00
R0731:Ripor2 UTSW 13 24680644 missense probably damaging 1.00
R0827:Ripor2 UTSW 13 24694186 missense probably damaging 1.00
R1331:Ripor2 UTSW 13 24677841 nonsense probably null
R1374:Ripor2 UTSW 13 24673112 critical splice donor site probably null
R1564:Ripor2 UTSW 13 24675785 missense probably damaging 1.00
R1773:Ripor2 UTSW 13 24701254 missense probably benign 0.10
R1889:Ripor2 UTSW 13 24693887 missense probably damaging 1.00
R2122:Ripor2 UTSW 13 24713718 missense probably damaging 0.98
R2137:Ripor2 UTSW 13 24721834 critical splice donor site probably null
R2209:Ripor2 UTSW 13 24701612 missense probably damaging 1.00
R2242:Ripor2 UTSW 13 24671772 missense probably benign 0.08
R2392:Ripor2 UTSW 13 24706223 missense probably benign 0.00
R2994:Ripor2 UTSW 13 24701627 missense probably damaging 0.98
R4008:Ripor2 UTSW 13 24696538 missense probably benign
R4287:Ripor2 UTSW 13 24725009 missense probably damaging 1.00
R4364:Ripor2 UTSW 13 24721711 missense probably benign 0.07
R4365:Ripor2 UTSW 13 24721711 missense probably benign 0.07
R4366:Ripor2 UTSW 13 24721711 missense probably benign 0.07
R4868:Ripor2 UTSW 13 24694141 missense possibly damaging 0.88
R5304:Ripor2 UTSW 13 24674666 missense probably damaging 0.99
R6119:Ripor2 UTSW 13 24614644 start gained probably benign
R6157:Ripor2 UTSW 13 24701069 missense probably damaging 1.00
R6178:Ripor2 UTSW 13 24710130 missense possibly damaging 0.94
R6382:Ripor2 UTSW 13 24677845 missense possibly damaging 0.89
R6664:Ripor2 UTSW 13 24675820 missense probably damaging 0.98
R6908:Ripor2 UTSW 13 24706232 missense probably damaging 1.00
R7023:Ripor2 UTSW 13 24671846 missense probably benign 0.00
R7041:Ripor2 UTSW 13 24693766 missense probably benign 0.18
R7196:Ripor2 UTSW 13 24704825 missense possibly damaging 0.66
R7216:Ripor2 UTSW 13 24671903 missense probably damaging 1.00
R7248:Ripor2 UTSW 13 24694145 missense probably damaging 1.00
R7299:Ripor2 UTSW 13 24725001 missense possibly damaging 0.54
R7301:Ripor2 UTSW 13 24725001 missense possibly damaging 0.54
R7343:Ripor2 UTSW 13 24701444 nonsense probably null
R7417:Ripor2 UTSW 13 24696550 missense probably damaging 1.00
R7426:Ripor2 UTSW 13 24694205 missense probably benign 0.01
R7448:Ripor2 UTSW 13 24670071 missense possibly damaging 0.71
R7462:Ripor2 UTSW 13 24696307 missense unknown
Predicted Primers PCR Primer
(F):5'- GCACTCCTAAACTGGTCCAG -3'
(R):5'- GCACACAGAGAGACCTATGG -3'

Sequencing Primer
(F):5'- GGTCCAGATTTGTTACAACACGGC -3'
(R):5'- ACCAAGGGATCATTGGGCC -3'
Posted On2019-10-17