Incidental Mutation 'R7499:Dmc1'
ID581399
Institutional Source Beutler Lab
Gene Symbol Dmc1
Ensembl Gene ENSMUSG00000022429
Gene NameDNA meiotic recombinase 1
SynonymsDmc1h, sgdp, Dmc1, Mei11
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.789) question?
Stock #R7499 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location79561497-79605109 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 79602420 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 11 (S11*)
Ref Sequence ENSEMBL: ENSMUSP00000023065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023065] [ENSMUST00000229408] [ENSMUST00000230011]
Predicted Effect probably null
Transcript: ENSMUST00000023065
AA Change: S11*
SMART Domains Protein: ENSMUSP00000023065
Gene: ENSMUSG00000022429
AA Change: S11*

DomainStartEndE-ValueType
HhH1 57 76 8.07e0 SMART
AAA 118 307 2.79e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000229408
AA Change: S11*
Predicted Effect probably null
Transcript: ENSMUST00000230011
AA Change: S11*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the superfamily of recombinases (also called DNA strand-exchange proteins). Recombinases are important for repairing double-strand DNA breaks during mitosis and meiosis. This protein, which is evolutionarily conserved, is reported to be essential for meiotic homologous recombination and may thus play an important role in generating diversity of genetic information. In mouse, deficiency of this gene causes infertility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygotes for targeted mutations are sterile with failure of homologous pairing in meiotic prophase in males and disrupted oogenesis in embryonic females with absence of germ cells in the adult ovary. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T A 9: 55,999,902 D180V possibly damaging Het
Abat T C 16: 8,603,754 probably null Het
Ankfn1 G A 11: 89,391,750 T357I probably benign Het
Armc3 C T 2: 19,285,979 T423I probably benign Het
Asb6 T C 2: 30,824,460 T213A possibly damaging Het
Atp11a T C 8: 12,832,575 C488R probably benign Het
Bag6 G A 17: 35,144,392 R736H probably benign Het
Bche G A 3: 73,701,898 P65L probably damaging Het
Cela3a T A 4: 137,405,639 I101F probably damaging Het
Cep170 A T 1: 176,774,462 D359E probably damaging Het
Chfr T C 5: 110,151,683 V314A probably benign Het
Clpb T C 7: 101,722,728 F224L possibly damaging Het
Coro2a T C 4: 46,539,188 K527R probably benign Het
Cpa5 A G 6: 30,630,857 T373A possibly damaging Het
Ctsd A T 7: 142,383,412 probably null Het
Dlx5 G A 6: 6,878,340 S230F possibly damaging Het
Dlx5 A C 6: 6,878,341 S230A probably benign Het
Dnah1 G A 14: 31,315,122 Q256* probably null Het
Dnah3 A G 7: 120,060,912 F846L probably damaging Het
Dnah5 A T 15: 28,302,450 I1618F probably damaging Het
Emsy A G 7: 98,630,331 V267A possibly damaging Het
Fgfr3 GGACCTCTCCGTG GG 5: 33,735,422 probably null Het
Frem1 T C 4: 83,005,770 I317M probably damaging Het
G6pc C A 11: 101,376,694 Y323* probably null Het
Gm5114 A G 7: 39,409,065 C377R possibly damaging Het
Gm7361 C A 5: 26,261,190 H183Q probably benign Het
Hmbox1 A G 14: 64,896,677 V158A possibly damaging Het
Hmg20a A G 9: 56,488,943 R340G unknown Het
Ifi206 T A 1: 173,482,041 I130F Het
Ifnb1 T C 4: 88,522,674 N34S probably benign Het
Il16 T C 7: 83,674,494 K283E probably damaging Het
Maf T C 8: 115,693,181 D374G probably benign Het
Mettl14 A G 3: 123,374,854 I179T probably benign Het
Mpped1 G A 15: 83,800,050 R91H probably damaging Het
Nop2 C A 6: 125,144,208 P651Q possibly damaging Het
Olfr486 A G 7: 108,171,800 *315Q probably null Het
Phkg1 G A 5: 129,873,268 Q89* probably null Het
Phykpl T A 11: 51,591,458 V133E probably damaging Het
Polr3gl A T 3: 96,579,821 Y183N probably benign Het
Pqlc2 T A 4: 139,306,512 D32V probably damaging Het
Rab13 A G 3: 90,225,533 T187A probably benign Het
Ripor2 A G 13: 24,693,772 M252V probably damaging Het
Sec61a2 T C 2: 5,877,914 N186S probably benign Het
Serpinb5 T C 1: 106,872,389 probably null Het
Serpine3 G A 14: 62,665,027 W29* probably null Het
Sh2b3 T C 5: 121,818,473 R382G probably damaging Het
Slc7a5 A G 8: 121,883,722 L451P probably damaging Het
Slco1a5 T C 6: 142,262,531 probably null Het
Tep1 G A 14: 50,853,590 A695V probably damaging Het
Tnik T C 3: 28,630,594 V857A possibly damaging Het
Trdn A T 10: 33,196,101 M255L probably benign Het
Tsc22d4 G A 5: 137,747,723 S203N probably benign Het
Tsfm T C 10: 127,022,548 E316G possibly damaging Het
Tvp23b T C 11: 62,879,463 probably benign Het
Vgf C A 5: 137,032,245 D420E probably damaging Het
Zan G A 5: 137,464,356 P854S probably benign Het
Zfp831 T C 2: 174,644,023 S164P possibly damaging Het
Other mutations in Dmc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00717:Dmc1 APN 15 79596280 missense probably benign 0.11
IGL02817:Dmc1 APN 15 79588763 missense probably damaging 1.00
IGL03131:Dmc1 APN 15 79568691 missense probably benign 0.02
IGL03341:Dmc1 APN 15 79562545 missense probably benign 0.01
R0129:Dmc1 UTSW 15 79596240 splice site probably benign
R0395:Dmc1 UTSW 15 79588772 missense probably damaging 1.00
R0908:Dmc1 UTSW 15 79585689 missense probably damaging 1.00
R2219:Dmc1 UTSW 15 79585126 missense possibly damaging 0.77
R3706:Dmc1 UTSW 15 79562581 missense probably damaging 1.00
R6362:Dmc1 UTSW 15 79588823 missense probably benign 0.42
R7619:Dmc1 UTSW 15 79596242 critical splice donor site probably null
R8270:Dmc1 UTSW 15 79601545 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCATGCCAGTTGCTAAGTAG -3'
(R):5'- AGGCAGATCTCTGAGTCTGAGG -3'

Sequencing Primer
(F):5'- TTAGCACCCTTGCCAAAG -3'
(R):5'- TTACAGAGCAAGTTCTAGGATAGCC -3'
Posted On2019-10-17