Incidental Mutation 'R7500:Slc27a4'
ID581408
Institutional Source Beutler Lab
Gene Symbol Slc27a4
Ensembl Gene ENSMUSG00000059316
Gene Namesolute carrier family 27 (fatty acid transporter), member 4
SynonymsFATP4, fatty acid transport protein 4
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7500 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location29802634-29817522 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29812705 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 539 (V539A)
Ref Sequence ENSEMBL: ENSMUSP00000078971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080065]
Predicted Effect probably damaging
Transcript: ENSMUST00000080065
AA Change: V539A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000078971
Gene: ENSMUSG00000059316
AA Change: V539A

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:AMP-binding 80 512 1.2e-72 PFAM
Pfam:AMP-binding_C 520 595 2.3e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of fatty acid transport proteins, which are involved in translocation of long-chain fatty acids cross the plasma membrane. This protein is expressed at high levels on the apical side of mature enterocytes in the small intestine, and appears to be the principal fatty acid transporter in enterocytes. Clinical studies suggest this gene as a candidate gene for the insulin resistance syndrome. Mutations in this gene have been associated with ichthyosis prematurity syndrome. [provided by RefSeq, Apr 2010]
PHENOTYPE: Homozygous mutant mice are not viable. While mice of one mutant line die during early development, mice of other mutant lines die at birth exhibiting abnormal skin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1a A G 9: 119,344,498 M146V probably benign Het
Adcy1 C T 11: 7,144,762 R563C probably damaging Het
Ambn A T 5: 88,461,634 Y67F possibly damaging Het
Ankrd42 T A 7: 92,591,872 E426D probably benign Het
Ankzf1 A G 1: 75,197,979 T538A probably benign Het
Arhgap20 A G 9: 51,840,502 I418V probably benign Het
Arhgef28 A G 13: 97,978,495 Y616H probably benign Het
B4galt4 T C 16: 38,768,014 F340S probably damaging Het
Bmp1 C T 14: 70,490,122 E674K probably benign Het
C530008M17Rik A G 5: 76,658,058 R126G unknown Het
Ccr9 T A 9: 123,779,469 V72D probably damaging Het
Chd2 T A 7: 73,451,808 K1390I probably damaging Het
Col5a3 C T 9: 20,800,289 R513Q unknown Het
Cttnbp2 G T 6: 18,378,420 N1472K probably benign Het
Edn3 A G 2: 174,779,535 probably null Het
Eps15l1 A G 8: 72,382,790 F331L probably damaging Het
Gm45337 CACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCTACAGCCTCC CACAGCCTCC 7: 142,144,284 probably benign Het
Lrrc56 A G 7: 141,209,530 S487G probably benign Het
Moxd2 A G 6: 40,891,812 T93A probably benign Het
Ngp G T 9: 110,419,765 probably null Het
Npr2 T C 4: 43,650,415 V970A probably damaging Het
Olfr1252 T C 2: 89,721,937 Y58C possibly damaging Het
Olfr1436 T C 19: 12,298,677 S152G probably damaging Het
Olfr877 T C 9: 37,855,018 S67P probably damaging Het
Olfr945 T G 9: 39,258,466 I69L probably benign Het
Pdf A T 8: 107,047,149 F221I probably damaging Het
Plekhn1 A C 4: 156,233,314 S205R probably benign Het
Ppp6r1 G A 7: 4,636,130 A606V probably benign Het
Prpf38b C T 3: 108,905,130 V256I probably benign Het
Rbbp5 T A 1: 132,494,141 H291Q probably benign Het
Rnf169 T C 7: 99,980,238 E66G probably damaging Het
Rp1 T A 1: 4,311,278 N328Y unknown Het
Skint5 A T 4: 113,559,838 V1138E unknown Het
Smo G T 6: 29,755,535 R402L probably benign Het
Srgap2 A T 1: 131,436,831 L4Q probably damaging Het
Tbxas1 A T 6: 38,982,212 R110* probably null Het
Thoc7 A C 14: 13,951,204 probably null Het
Tmem206 A G 1: 191,346,713 probably null Het
Tmub1 G A 5: 24,447,509 probably benign Het
Tnrc6a A G 7: 123,173,450 probably null Het
Traj19 T A 14: 54,200,403 H6Q unknown Het
Trim30c T C 7: 104,387,551 E200G probably benign Het
Ubqlnl A T 7: 104,148,841 I483N probably damaging Het
Usp25 G T 16: 77,077,201 R555L probably damaging Het
Vgll4 A G 6: 114,862,332 S233P probably damaging Het
Vps13b G A 15: 35,910,524 C3478Y possibly damaging Het
Vwa8 T A 14: 78,925,246 probably null Het
Zfp977 A G 7: 42,580,205 Y299H probably damaging Het
Zmynd11 T A 13: 9,735,398 H17L probably benign Het
Other mutations in Slc27a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01132:Slc27a4 APN 2 29804302 missense probably benign 0.03
IGL01982:Slc27a4 APN 2 29812615 missense probably damaging 1.00
IGL02160:Slc27a4 APN 2 29805962 missense probably benign 0.04
IGL02290:Slc27a4 APN 2 29815729 missense probably damaging 1.00
IGL02382:Slc27a4 APN 2 29809843 missense probably damaging 1.00
IGL02738:Slc27a4 APN 2 29811226 missense probably benign 0.15
R0470:Slc27a4 UTSW 2 29804185 missense probably benign 0.10
R0688:Slc27a4 UTSW 2 29812615 missense probably damaging 1.00
R0847:Slc27a4 UTSW 2 29811249 missense probably benign 0.20
R1466:Slc27a4 UTSW 2 29811190 missense probably damaging 0.99
R1466:Slc27a4 UTSW 2 29811190 missense probably damaging 0.99
R1584:Slc27a4 UTSW 2 29811190 missense probably damaging 0.99
R1793:Slc27a4 UTSW 2 29805721 missense probably benign 0.00
R1804:Slc27a4 UTSW 2 29811267 missense probably benign 0.01
R2056:Slc27a4 UTSW 2 29810941 missense probably damaging 0.99
R4901:Slc27a4 UTSW 2 29812636 missense probably damaging 1.00
R5601:Slc27a4 UTSW 2 29805660 missense probably benign 0.30
R5663:Slc27a4 UTSW 2 29812370 missense probably damaging 1.00
R5934:Slc27a4 UTSW 2 29811660 missense probably damaging 0.96
R6196:Slc27a4 UTSW 2 29805750 missense probably benign 0.00
R6643:Slc27a4 UTSW 2 29812848 missense probably benign 0.01
R7033:Slc27a4 UTSW 2 29804271 missense possibly damaging 0.94
R7176:Slc27a4 UTSW 2 29811226 missense probably benign 0.15
R7179:Slc27a4 UTSW 2 29815652 nonsense probably null
R7192:Slc27a4 UTSW 2 29805929 missense probably damaging 1.00
R7301:Slc27a4 UTSW 2 29812932 missense probably null 0.99
R7810:Slc27a4 UTSW 2 29805710 missense probably benign 0.25
R8042:Slc27a4 UTSW 2 29811190 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTCATGACTAACTGTCCCCTC -3'
(R):5'- TTGTGCAGCTCAGGCAAGAAG -3'

Sequencing Primer
(F):5'- TCCCTAGGTGACGTCCTG -3'
(R):5'- GGCATACAGAGGCAGCTC -3'
Posted On2019-10-17