Incidental Mutation 'R0634:Lrmp'
ID58142
Institutional Source Beutler Lab
Gene Symbol Lrmp
Ensembl Gene ENSMUSG00000030263
Gene Namelymphoid-restricted membrane protein
SynonymsD6Int8, D6Int7, D6Int5, D6Int4, D6Int3, Jaw1
MMRRC Submission 038823-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0634 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location145115653-145174934 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 145174628 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 523 (H523L)
Ref Sequence ENSEMBL: ENSMUSP00000032396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032396] [ENSMUST00000060797] [ENSMUST00000111728] [ENSMUST00000135984] [ENSMUST00000204105]
Predicted Effect probably damaging
Transcript: ENSMUST00000032396
AA Change: H523L

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032396
Gene: ENSMUSG00000030263
AA Change: H523L

DomainStartEndE-ValueType
Pfam:MRVI1 10 539 3.2e-265 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000060797
SMART Domains Protein: ENSMUSP00000062279
Gene: ENSMUSG00000043541

DomainStartEndE-ValueType
low complexity region 1 14 N/A INTRINSIC
Pfam:Casc1_N 29 229 5.5e-61 PFAM
Pfam:Casc1 241 469 3.4e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111727
Predicted Effect probably benign
Transcript: ENSMUST00000111728
SMART Domains Protein: ENSMUSP00000107357
Gene: ENSMUSG00000043541

DomainStartEndE-ValueType
coiled coil region 1 45 N/A INTRINSIC
Pfam:Casc1 228 456 6.1e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132937
Predicted Effect unknown
Transcript: ENSMUST00000132948
AA Change: H487L
SMART Domains Protein: ENSMUSP00000120248
Gene: ENSMUSG00000030263
AA Change: H487L

DomainStartEndE-ValueType
Pfam:MRVI1 8 504 3.7e-248 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135191
Predicted Effect probably benign
Transcript: ENSMUST00000135984
Predicted Effect probably benign
Transcript: ENSMUST00000204105
SMART Domains Protein: ENSMUSP00000144783
Gene: ENSMUSG00000043541

DomainStartEndE-ValueType
low complexity region 1 14 N/A INTRINSIC
Pfam:Casc1_N 29 229 3.4e-57 PFAM
Pfam:Casc1 241 469 2.3e-11 PFAM
Meta Mutation Damage Score 0.2867 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.2%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encode dby this gene is expressed in a developmentally regulated manner in lymphoid cell lines and tissues. The protein is localized to the cytoplasmic face of the endoplasmic reticulum. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,314,491 I2958V possibly damaging Het
Adam21 C A 12: 81,560,352 W212L probably benign Het
Adcy2 A C 13: 68,727,945 H479Q possibly damaging Het
Adcy4 T C 14: 55,781,597 R168G probably benign Het
Atp13a2 T C 4: 141,006,929 probably benign Het
C1ra G A 6: 124,517,505 E304K possibly damaging Het
C87977 A G 4: 144,209,340 probably null Het
Cc2d2a A C 5: 43,681,381 probably benign Het
Cenpe T C 3: 135,246,827 L1426P probably damaging Het
Cntn1 A T 15: 92,314,563 R869* probably null Het
Creb3l2 A T 6: 37,334,348 probably benign Het
Crybg2 G A 4: 134,075,304 probably benign Het
Csmd1 A T 8: 16,226,391 F800I probably damaging Het
Dock6 G A 9: 21,841,527 T330I probably damaging Het
Ets2 G A 16: 95,716,156 E311K possibly damaging Het
Fbxo22 A T 9: 55,214,960 Q141L probably benign Het
Fer C T 17: 64,035,508 T223M probably benign Het
Gm13757 A T 2: 88,446,617 M107K probably benign Het
Gm9774 C T 3: 92,428,809 W125* probably null Het
Gtf3c1 A T 7: 125,657,477 probably benign Het
Gtf3c2 G A 5: 31,159,806 R684* probably null Het
Hs6st3 T A 14: 119,869,062 L294* probably null Het
Ighg2c T G 12: 113,287,964 E181A unknown Het
Igkv6-15 A T 6: 70,406,779 probably benign Het
Map2k6 C T 11: 110,494,343 R178* probably null Het
Meikin T A 11: 54,390,483 D126E probably benign Het
Mgst1 A T 6: 138,156,331 T37S probably damaging Het
Mrc2 G A 11: 105,347,692 V1222M probably benign Het
Myom2 C A 8: 15,119,216 probably benign Het
Negr1 A G 3: 157,016,266 K159R possibly damaging Het
Nptx1 T C 11: 119,543,301 T320A possibly damaging Het
Olfr490 T C 7: 108,286,296 I277V probably benign Het
Olfr530 A T 7: 140,373,397 V71E possibly damaging Het
Pes1 C T 11: 3,977,794 probably benign Het
Pes1 T G 11: 3,977,795 probably benign Het
Pkhd1 A T 1: 20,117,474 Y3537N probably damaging Het
Poteg G A 8: 27,473,587 G289R probably benign Het
Rassf5 T C 1: 131,244,956 R59G probably damaging Het
Reln A T 5: 22,018,869 W961R probably damaging Het
Rhot2 G A 17: 25,842,028 H168Y possibly damaging Het
Ripk3 G T 14: 55,788,391 probably benign Het
Samm50 A G 15: 84,214,171 silent Het
Sap30bp T C 11: 115,957,403 I117T probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Sipa1l2 A T 8: 125,422,624 L1632* probably null Het
Sirt7 T C 11: 120,622,129 probably benign Het
Smg8 T C 11: 87,086,108 T216A possibly damaging Het
Sox9 A G 11: 112,784,942 Y319C probably damaging Het
Sspn G A 6: 145,961,151 A27T possibly damaging Het
Suco A G 1: 161,838,804 V509A possibly damaging Het
Svep1 C T 4: 58,070,661 C2375Y possibly damaging Het
Trbv21 T A 6: 41,203,050 probably benign Het
Uimc1 C T 13: 55,060,266 E455K possibly damaging Het
Upk3b A G 5: 136,040,076 T100A possibly damaging Het
Usp47 A G 7: 112,108,655 N1303D probably damaging Het
Vav1 A T 17: 57,303,862 D476V probably benign Het
Vmn1r68 A G 7: 10,527,235 V312A probably benign Het
Wdr62 A G 7: 30,270,174 V287A probably damaging Het
Zcchc4 C T 5: 52,783,208 P40S probably benign Het
Zfp326 T A 5: 105,886,203 Y26* probably null Het
Zfp592 A G 7: 81,038,071 H915R probably damaging Het
Other mutations in Lrmp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00918:Lrmp APN 6 145167994 missense probably damaging 1.00
IGL01066:Lrmp APN 6 145160955 missense probably damaging 1.00
IGL01877:Lrmp APN 6 145147799 missense probably damaging 0.99
IGL02154:Lrmp APN 6 145138241 missense possibly damaging 0.92
IGL02727:Lrmp APN 6 145174618 missense possibly damaging 0.78
FR4976:Lrmp UTSW 6 145173785 unclassified probably benign
R0238:Lrmp UTSW 6 145171978 unclassified probably benign
R0239:Lrmp UTSW 6 145171978 unclassified probably benign
R0454:Lrmp UTSW 6 145167984 missense possibly damaging 0.73
R0485:Lrmp UTSW 6 145165212 missense probably damaging 1.00
R0487:Lrmp UTSW 6 145165260 missense probably benign 0.02
R0554:Lrmp UTSW 6 145165287 missense probably benign 0.01
R1440:Lrmp UTSW 6 145174511 missense possibly damaging 0.77
R1574:Lrmp UTSW 6 145158630 splice site probably benign
R1697:Lrmp UTSW 6 145137615 splice site probably benign
R1968:Lrmp UTSW 6 145169773 missense probably damaging 0.98
R3735:Lrmp UTSW 6 145160870 splice site probably benign
R3736:Lrmp UTSW 6 145160870 splice site probably benign
R4643:Lrmp UTSW 6 145168060 missense probably benign 0.17
R4812:Lrmp UTSW 6 145148011 missense probably damaging 1.00
R4916:Lrmp UTSW 6 145165301 missense probably damaging 1.00
R5183:Lrmp UTSW 6 145138220 missense probably benign 0.23
R5845:Lrmp UTSW 6 145171666 missense probably benign 0.00
R6701:Lrmp UTSW 6 145144976 nonsense probably null
R6735:Lrmp UTSW 6 145160893 missense probably damaging 1.00
R7083:Lrmp UTSW 6 145169783 missense probably damaging 1.00
R7317:Lrmp UTSW 6 145158698 missense possibly damaging 0.93
R7468:Lrmp UTSW 6 145173701 splice site probably null
RF003:Lrmp UTSW 6 145173783 unclassified probably benign
RF015:Lrmp UTSW 6 145173783 unclassified probably benign
RF017:Lrmp UTSW 6 145173784 unclassified probably benign
RF027:Lrmp UTSW 6 145173790 unclassified probably benign
RF029:Lrmp UTSW 6 145173790 unclassified probably benign
RF030:Lrmp UTSW 6 145173788 unclassified probably benign
RF030:Lrmp UTSW 6 145173790 unclassified probably benign
RF038:Lrmp UTSW 6 145173790 unclassified probably benign
RF043:Lrmp UTSW 6 145173790 unclassified probably benign
RF044:Lrmp UTSW 6 145173790 unclassified probably benign
RF048:Lrmp UTSW 6 145173784 unclassified probably benign
RF052:Lrmp UTSW 6 145160531 critical splice acceptor site probably benign
RF054:Lrmp UTSW 6 145173788 unclassified probably benign
RF055:Lrmp UTSW 6 145173785 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CGTCCTTCAGAAGAGCCAACAGAG -3'
(R):5'- TTTAAGAGCACCAGGCGTTCCAG -3'

Sequencing Primer
(F):5'- GAGCCAACAGAGCACTCTGG -3'
(R):5'- TCTGATGCCTCTCACTCAGAAAG -3'
Posted On2013-07-11