Incidental Mutation 'R7500:Trim30c'
ID581426
Institutional Source Beutler Lab
Gene Symbol Trim30c
Ensembl Gene ENSMUSG00000078616
Gene Nametripartite motif-containing 30C
SynonymsGm5598, Trim30-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R7500 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location104382065-104400837 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104387551 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 200 (E200G)
Ref Sequence ENSEMBL: ENSMUSP00000102441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106828]
Predicted Effect probably benign
Transcript: ENSMUST00000106828
AA Change: E200G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000102441
Gene: ENSMUSG00000078616
AA Change: E200G

DomainStartEndE-ValueType
RING 16 59 2.51e-10 SMART
BBOX 92 133 2.02e-14 SMART
low complexity region 197 229 N/A INTRINSIC
Pfam:SPRY 356 495 1.9e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1a A G 9: 119,344,498 M146V probably benign Het
Adcy1 C T 11: 7,144,762 R563C probably damaging Het
Ambn A T 5: 88,461,634 Y67F possibly damaging Het
Ankrd42 T A 7: 92,591,872 E426D probably benign Het
Ankzf1 A G 1: 75,197,979 T538A probably benign Het
Arhgap20 A G 9: 51,840,502 I418V probably benign Het
Arhgef28 A G 13: 97,978,495 Y616H probably benign Het
B4galt4 T C 16: 38,768,014 F340S probably damaging Het
Bmp1 C T 14: 70,490,122 E674K probably benign Het
C530008M17Rik A G 5: 76,658,058 R126G unknown Het
Ccr9 T A 9: 123,779,469 V72D probably damaging Het
Chd2 T A 7: 73,451,808 K1390I probably damaging Het
Col5a3 C T 9: 20,800,289 R513Q unknown Het
Cttnbp2 G T 6: 18,378,420 N1472K probably benign Het
Edn3 A G 2: 174,779,535 probably null Het
Eps15l1 A G 8: 72,382,790 F331L probably damaging Het
Gm45337 CACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCTACAGCCTCC CACAGCCTCC 7: 142,144,284 probably benign Het
Lrrc56 A G 7: 141,209,530 S487G probably benign Het
Moxd2 A G 6: 40,891,812 T93A probably benign Het
Ngp G T 9: 110,419,765 probably null Het
Npr2 T C 4: 43,650,415 V970A probably damaging Het
Olfr1252 T C 2: 89,721,937 Y58C possibly damaging Het
Olfr1436 T C 19: 12,298,677 S152G probably damaging Het
Olfr877 T C 9: 37,855,018 S67P probably damaging Het
Olfr945 T G 9: 39,258,466 I69L probably benign Het
Pdf A T 8: 107,047,149 F221I probably damaging Het
Plekhn1 A C 4: 156,233,314 S205R probably benign Het
Ppp6r1 G A 7: 4,636,130 A606V probably benign Het
Prpf38b C T 3: 108,905,130 V256I probably benign Het
Rbbp5 T A 1: 132,494,141 H291Q probably benign Het
Rnf169 T C 7: 99,980,238 E66G probably damaging Het
Rp1 T A 1: 4,311,278 N328Y unknown Het
Skint5 A T 4: 113,559,838 V1138E unknown Het
Slc27a4 T C 2: 29,812,705 V539A probably damaging Het
Smo G T 6: 29,755,535 R402L probably benign Het
Srgap2 A T 1: 131,436,831 L4Q probably damaging Het
Tbxas1 A T 6: 38,982,212 R110* probably null Het
Thoc7 A C 14: 13,951,204 probably null Het
Tmem206 A G 1: 191,346,713 probably null Het
Tmub1 G A 5: 24,447,509 probably benign Het
Tnrc6a A G 7: 123,173,450 probably null Het
Traj19 T A 14: 54,200,403 H6Q unknown Het
Ubqlnl A T 7: 104,148,841 I483N probably damaging Het
Usp25 G T 16: 77,077,201 R555L probably damaging Het
Vgll4 A G 6: 114,862,332 S233P probably damaging Het
Vps13b G A 15: 35,910,524 C3478Y possibly damaging Het
Vwa8 T A 14: 78,925,246 probably null Het
Zfp977 A G 7: 42,580,205 Y299H probably damaging Het
Zmynd11 T A 13: 9,735,398 H17L probably benign Het
Other mutations in Trim30c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Trim30c APN 7 104382182 nonsense probably null
IGL00573:Trim30c APN 7 104382631 missense possibly damaging 0.66
IGL01023:Trim30c APN 7 104382972 splice site probably benign
IGL01413:Trim30c APN 7 104382334 missense possibly damaging 0.85
IGL01418:Trim30c APN 7 104382334 missense possibly damaging 0.85
IGL02330:Trim30c APN 7 104382958 missense possibly damaging 0.61
IGL02389:Trim30c APN 7 104382174 missense probably benign 0.00
IGL03107:Trim30c APN 7 104382613 missense possibly damaging 0.95
R0195:Trim30c UTSW 7 104382429 missense probably benign
R0324:Trim30c UTSW 7 104383309 missense possibly damaging 0.79
R0826:Trim30c UTSW 7 104383481 missense probably benign 0.01
R0865:Trim30c UTSW 7 104390451 missense probably damaging 1.00
R1484:Trim30c UTSW 7 104383252 missense probably benign 0.00
R1513:Trim30c UTSW 7 104382689 missense probably benign 0.04
R1563:Trim30c UTSW 7 104382951 missense probably benign 0.00
R2220:Trim30c UTSW 7 104383267 missense probably benign
R2442:Trim30c UTSW 7 104382274 missense probably damaging 1.00
R5326:Trim30c UTSW 7 104388304 missense possibly damaging 0.89
R5777:Trim30c UTSW 7 104383331 missense probably benign 0.08
R6118:Trim30c UTSW 7 104382081 missense probably benign 0.01
R6257:Trim30c UTSW 7 104390168 missense probably damaging 1.00
R6374:Trim30c UTSW 7 104390402 missense probably benign 0.01
R7387:Trim30c UTSW 7 104390190 missense probably damaging 1.00
R7419:Trim30c UTSW 7 104388265 missense probably benign 0.11
R7542:Trim30c UTSW 7 104382218 missense possibly damaging 0.95
Z1176:Trim30c UTSW 7 104383258 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTAACTCTCAGACACTGGGACC -3'
(R):5'- ACACCGCTTCCCAAAGGTTC -3'

Sequencing Primer
(F):5'- TCTCAGACACTGGGACCTCCTG -3'
(R):5'- CTAAGCCCAAGTCCCTGTG -3'
Posted On2019-10-17