Incidental Mutation 'R7500:Ccr9'
ID581436
Institutional Source Beutler Lab
Gene Symbol Ccr9
Ensembl Gene ENSMUSG00000029530
Gene Namechemokine (C-C motif) receptor 9
SynonymsCmkbr10, GPR-9-6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R7500 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location123678439-123784330 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 123779469 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 72 (V72D)
Ref Sequence ENSEMBL: ENSMUSP00000131782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111454] [ENSMUST00000163559] [ENSMUST00000166236] [ENSMUST00000168910] [ENSMUST00000180093]
Predicted Effect probably damaging
Transcript: ENSMUST00000111454
AA Change: V60D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107081
Gene: ENSMUSG00000029530
AA Change: V60D

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 47 320 1.2e-5 PFAM
Pfam:7tm_1 53 305 1.1e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163559
AA Change: V72D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131782
Gene: ENSMUSG00000029530
AA Change: V72D

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 59 332 5.9e-6 PFAM
Pfam:7tm_1 65 317 3.4e-52 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166236
AA Change: V72D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127024
Gene: ENSMUSG00000029530
AA Change: V72D

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 59 332 5.9e-6 PFAM
Pfam:7tm_1 65 317 4.6e-47 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168910
AA Change: V72D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126758
Gene: ENSMUSG00000029530
AA Change: V72D

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 59 332 5.9e-6 PFAM
Pfam:7tm_1 65 317 3.4e-52 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000180093
AA Change: V72D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137144
Gene: ENSMUSG00000029530
AA Change: V72D

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 59 332 5.9e-6 PFAM
Pfam:7tm_1 65 317 3.4e-52 PFAM
Meta Mutation Damage Score 0.8136 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the beta chemokine receptor family. It is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. Chemokines and their receptors are key regulators of the thymocytes migration and maturation in normal and inflammation conditions. The specific ligand of this receptor is CCL25. It has been found that this gene is differentially expressed by T lymphocytes of small intestine and colon, suggested a role in the thymocytes recruitment and development that may permit functional specialization of immune responses in different segment of the gastrointestinal tract. This gene is mapped to the chemokine receptor gene cluster region. Two alternatively spliced transcript variants have been described. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null mice have altered trafficing of lymphocytes to the intestine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1a A G 9: 119,344,498 M146V probably benign Het
Adcy1 C T 11: 7,144,762 R563C probably damaging Het
Ambn A T 5: 88,461,634 Y67F possibly damaging Het
Ankrd42 T A 7: 92,591,872 E426D probably benign Het
Ankzf1 A G 1: 75,197,979 T538A probably benign Het
Arhgap20 A G 9: 51,840,502 I418V probably benign Het
Arhgef28 A G 13: 97,978,495 Y616H probably benign Het
B4galt4 T C 16: 38,768,014 F340S probably damaging Het
Bmp1 C T 14: 70,490,122 E674K probably benign Het
C530008M17Rik A G 5: 76,658,058 R126G unknown Het
Chd2 T A 7: 73,451,808 K1390I probably damaging Het
Col5a3 C T 9: 20,800,289 R513Q unknown Het
Cttnbp2 G T 6: 18,378,420 N1472K probably benign Het
Edn3 A G 2: 174,779,535 probably null Het
Eps15l1 A G 8: 72,382,790 F331L probably damaging Het
Gm45337 CACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCTACAGCCTCC CACAGCCTCC 7: 142,144,284 probably benign Het
Lrrc56 A G 7: 141,209,530 S487G probably benign Het
Moxd2 A G 6: 40,891,812 T93A probably benign Het
Ngp G T 9: 110,419,765 probably null Het
Npr2 T C 4: 43,650,415 V970A probably damaging Het
Olfr1252 T C 2: 89,721,937 Y58C possibly damaging Het
Olfr1436 T C 19: 12,298,677 S152G probably damaging Het
Olfr877 T C 9: 37,855,018 S67P probably damaging Het
Olfr945 T G 9: 39,258,466 I69L probably benign Het
Pdf A T 8: 107,047,149 F221I probably damaging Het
Plekhn1 A C 4: 156,233,314 S205R probably benign Het
Ppp6r1 G A 7: 4,636,130 A606V probably benign Het
Prpf38b C T 3: 108,905,130 V256I probably benign Het
Rbbp5 T A 1: 132,494,141 H291Q probably benign Het
Rnf169 T C 7: 99,980,238 E66G probably damaging Het
Rp1 T A 1: 4,311,278 N328Y unknown Het
Skint5 A T 4: 113,559,838 V1138E unknown Het
Slc27a4 T C 2: 29,812,705 V539A probably damaging Het
Smo G T 6: 29,755,535 R402L probably benign Het
Srgap2 A T 1: 131,436,831 L4Q probably damaging Het
Tbxas1 A T 6: 38,982,212 R110* probably null Het
Thoc7 A C 14: 13,951,204 probably null Het
Tmem206 A G 1: 191,346,713 probably null Het
Tmub1 G A 5: 24,447,509 probably benign Het
Tnrc6a A G 7: 123,173,450 probably null Het
Traj19 T A 14: 54,200,403 H6Q unknown Het
Trim30c T C 7: 104,387,551 E200G probably benign Het
Ubqlnl A T 7: 104,148,841 I483N probably damaging Het
Usp25 G T 16: 77,077,201 R555L probably damaging Het
Vgll4 A G 6: 114,862,332 S233P probably damaging Het
Vps13b G A 15: 35,910,524 C3478Y possibly damaging Het
Vwa8 T A 14: 78,925,246 probably null Het
Zfp977 A G 7: 42,580,205 Y299H probably damaging Het
Zmynd11 T A 13: 9,735,398 H17L probably benign Het
Other mutations in Ccr9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Ccr9 APN 9 123780044 missense probably benign 0.00
IGL00983:Ccr9 APN 9 123779286 missense probably benign
IGL02466:Ccr9 APN 9 123779846 missense probably damaging 1.00
IGL03151:Ccr9 APN 9 123774573 utr 5 prime probably benign
IGL03302:Ccr9 APN 9 123779536 missense probably damaging 1.00
hamlet UTSW 9 123779439 missense probably damaging 1.00
Laertes UTSW 9 123779846 missense probably damaging 1.00
Ophelia UTSW 9 123779469 missense probably damaging 1.00
R0310:Ccr9 UTSW 9 123774552 utr 5 prime probably benign
R0393:Ccr9 UTSW 9 123779970 missense probably benign 0.18
R0421:Ccr9 UTSW 9 123779606 missense probably benign
R2069:Ccr9 UTSW 9 123779364 missense probably benign 0.05
R3980:Ccr9 UTSW 9 123779376 missense probably benign 0.14
R4645:Ccr9 UTSW 9 123779593 missense probably benign 0.00
R4672:Ccr9 UTSW 9 123779687 missense probably damaging 0.96
R4920:Ccr9 UTSW 9 123779439 missense probably damaging 1.00
R5661:Ccr9 UTSW 9 123780099 missense probably benign 0.04
R5964:Ccr9 UTSW 9 123779434 missense probably benign 0.12
R7037:Ccr9 UTSW 9 123779971 missense possibly damaging 0.52
R7620:Ccr9 UTSW 9 123779846 missense probably damaging 1.00
R7670:Ccr9 UTSW 9 123779306 missense probably damaging 0.98
R7762:Ccr9 UTSW 9 123779957 missense probably benign 0.08
R8154:Ccr9 UTSW 9 123779831 missense probably benign 0.00
R8283:Ccr9 UTSW 9 123779631 missense probably damaging 1.00
X0026:Ccr9 UTSW 9 123779501 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCATGTTTGATGACTTCAGC -3'
(R):5'- TCTGTCCACACTGATGCACATG -3'

Sequencing Primer
(F):5'- GATGACTTCAGCTATGACTCCACTG -3'
(R):5'- GCACACAGCTGTAGAAGTTCATCTTG -3'
Posted On2019-10-17