Incidental Mutation 'R7500:Bmp1'
ID 581442
Institutional Source Beutler Lab
Gene Symbol Bmp1
Ensembl Gene ENSMUSG00000022098
Gene Name bone morphogenetic protein 1
Synonyms
MMRRC Submission 045573-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7500 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 70474558-70520234 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 70490122 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 674 (E674K)
Ref Sequence ENSEMBL: ENSMUSP00000022693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022693] [ENSMUST00000226246] [ENSMUST00000226906] [ENSMUST00000227944]
AlphaFold P98063
Predicted Effect probably benign
Transcript: ENSMUST00000022693
AA Change: E674K

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000022693
Gene: ENSMUSG00000022098
AA Change: E674K

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
ZnMc 131 273 1.32e-54 SMART
CUB 327 439 4.35e-43 SMART
CUB 440 552 7.86e-50 SMART
EGF_CA 552 593 5.03e-11 SMART
CUB 596 708 1.13e-50 SMART
EGF_CA 708 748 4.81e-8 SMART
CUB 752 864 3.99e-51 SMART
CUB 865 981 7.35e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226246
Predicted Effect probably benign
Transcript: ENSMUST00000226906
Predicted Effect probably benign
Transcript: ENSMUST00000227944
Meta Mutation Damage Score 0.1907 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: This gene encodes a metalloproteinase that plays an essential role in the formation of the extracellular matrix and is also able to induce ectopic bone formation. Unlike other bone morphogenetic proteins, the protein encoded by this gene is not closely related to transforming growth factor-beta. This protein plays in role several developmental processes. In humans, mutations in this gene are associated with osteogenesis imperfecta and with increased bone mineral density and multiple recurrent fractures. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous targeted mutant embryos have reduced ossification of the skull, persistent herniation of the gut, abnormal collagen fibrils in the amnion, and die at birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1a A G 9: 119,344,498 M146V probably benign Het
Adcy1 C T 11: 7,144,762 R563C probably damaging Het
Ambn A T 5: 88,461,634 Y67F possibly damaging Het
Ankrd42 T A 7: 92,591,872 E426D probably benign Het
Ankzf1 A G 1: 75,197,979 T538A probably benign Het
Arhgap20 A G 9: 51,840,502 I418V probably benign Het
Arhgef28 A G 13: 97,978,495 Y616H probably benign Het
B4galt4 T C 16: 38,768,014 F340S probably damaging Het
C530008M17Rik A G 5: 76,658,058 R126G unknown Het
Ccr9 T A 9: 123,779,469 V72D probably damaging Het
Chd2 T A 7: 73,451,808 K1390I probably damaging Het
Col5a3 C T 9: 20,800,289 R513Q unknown Het
Cttnbp2 G T 6: 18,378,420 N1472K probably benign Het
Edn3 A G 2: 174,779,535 probably null Het
Eps15l1 A G 8: 72,382,790 F331L probably damaging Het
Gm45337 CACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCTACAGCCTCC CACAGCCTCC 7: 142,144,284 probably benign Het
Lrrc56 A G 7: 141,209,530 S487G probably benign Het
Moxd2 A G 6: 40,891,812 T93A probably benign Het
Ngp G T 9: 110,419,765 probably null Het
Npr2 T C 4: 43,650,415 V970A probably damaging Het
Olfr1252 T C 2: 89,721,937 Y58C possibly damaging Het
Olfr1436 T C 19: 12,298,677 S152G probably damaging Het
Olfr877 T C 9: 37,855,018 S67P probably damaging Het
Olfr945 T G 9: 39,258,466 I69L probably benign Het
Pdf A T 8: 107,047,149 F221I probably damaging Het
Plekhn1 A C 4: 156,233,314 S205R probably benign Het
Ppp6r1 G A 7: 4,636,130 A606V probably benign Het
Prpf38b C T 3: 108,905,130 V256I probably benign Het
Rbbp5 T A 1: 132,494,141 H291Q probably benign Het
Rnf169 T C 7: 99,980,238 E66G probably damaging Het
Rp1 T A 1: 4,311,278 N328Y unknown Het
Skint5 A T 4: 113,559,838 V1138E unknown Het
Slc27a4 T C 2: 29,812,705 V539A probably damaging Het
Smo G T 6: 29,755,535 R402L probably benign Het
Srgap2 A T 1: 131,436,831 L4Q probably damaging Het
Tbxas1 A T 6: 38,982,212 R110* probably null Het
Thoc7 A C 14: 13,951,204 probably null Het
Tmem206 A G 1: 191,346,713 probably null Het
Tmub1 G A 5: 24,447,509 probably benign Het
Tnrc6a A G 7: 123,173,450 probably null Het
Traj19 T A 14: 54,200,403 H6Q unknown Het
Trim30c T C 7: 104,387,551 E200G probably benign Het
Ubqlnl A T 7: 104,148,841 I483N probably damaging Het
Usp25 G T 16: 77,077,201 R555L probably damaging Het
Vgll4 A G 6: 114,862,332 S233P probably damaging Het
Vps13b G A 15: 35,910,524 C3478Y possibly damaging Het
Vwa8 T A 14: 78,925,246 probably null Het
Zfp977 A G 7: 42,580,205 Y299H probably damaging Het
Zmynd11 T A 13: 9,735,398 H17L probably benign Het
Other mutations in Bmp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Bmp1 APN 14 70492461 missense probably damaging 1.00
IGL02065:Bmp1 APN 14 70486220 missense probably damaging 0.97
IGL02065:Bmp1 APN 14 70490107 missense probably damaging 0.99
IGL02349:Bmp1 APN 14 70507549 missense possibly damaging 0.61
IGL02486:Bmp1 APN 14 70504776 missense possibly damaging 0.48
PIT4519001:Bmp1 UTSW 14 70490029 missense possibly damaging 0.65
R0394:Bmp1 UTSW 14 70490034 missense probably damaging 0.99
R1371:Bmp1 UTSW 14 70492466 missense probably damaging 1.00
R1604:Bmp1 UTSW 14 70508004 missense possibly damaging 0.66
R1732:Bmp1 UTSW 14 70486265 missense possibly damaging 0.67
R1834:Bmp1 UTSW 14 70508831 missense possibly damaging 0.73
R2008:Bmp1 UTSW 14 70492466 missense probably damaging 1.00
R2197:Bmp1 UTSW 14 70486272 missense possibly damaging 0.83
R3157:Bmp1 UTSW 14 70492107 missense possibly damaging 0.63
R4397:Bmp1 UTSW 14 70490542 splice site probably null
R4609:Bmp1 UTSW 14 70477966 missense probably benign 0.00
R4613:Bmp1 UTSW 14 70508523 missense probably damaging 1.00
R4675:Bmp1 UTSW 14 70492844 missense probably damaging 0.99
R4796:Bmp1 UTSW 14 70492073 splice site probably null
R4884:Bmp1 UTSW 14 70475215 missense probably benign 0.01
R4905:Bmp1 UTSW 14 70491362 missense probably benign 0.06
R5088:Bmp1 UTSW 14 70486219 missense possibly damaging 0.84
R5225:Bmp1 UTSW 14 70480165 missense probably damaging 0.97
R5271:Bmp1 UTSW 14 70508128 missense probably benign 0.34
R5625:Bmp1 UTSW 14 70486166 missense probably benign 0.19
R5653:Bmp1 UTSW 14 70490094 missense probably benign 0.00
R6155:Bmp1 UTSW 14 70508007 missense probably damaging 1.00
R6295:Bmp1 UTSW 14 70491383 missense possibly damaging 0.88
R6618:Bmp1 UTSW 14 70491368 missense probably damaging 1.00
R6649:Bmp1 UTSW 14 70490618 missense probably damaging 1.00
R6653:Bmp1 UTSW 14 70490618 missense probably damaging 1.00
R6951:Bmp1 UTSW 14 70508858 missense probably benign 0.26
R6983:Bmp1 UTSW 14 70508207 missense probably damaging 0.96
R7207:Bmp1 UTSW 14 70479560 missense possibly damaging 0.56
R7716:Bmp1 UTSW 14 70477922 nonsense probably null
R7749:Bmp1 UTSW 14 70492844 missense probably damaging 1.00
R7763:Bmp1 UTSW 14 70492084 missense probably damaging 1.00
R7834:Bmp1 UTSW 14 70508565 missense probably damaging 1.00
R8232:Bmp1 UTSW 14 70519889 missense probably damaging 0.97
R8490:Bmp1 UTSW 14 70490133 missense possibly damaging 0.94
R8827:Bmp1 UTSW 14 70490642 missense probably damaging 1.00
R8945:Bmp1 UTSW 14 70490190 missense probably damaging 1.00
R9178:Bmp1 UTSW 14 70490173 missense possibly damaging 0.78
R9228:Bmp1 UTSW 14 70519898 missense probably benign
R9621:Bmp1 UTSW 14 70477866 missense probably benign 0.29
R9652:Bmp1 UTSW 14 70477920 missense probably damaging 1.00
X0028:Bmp1 UTSW 14 70508537 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATATTCAGATGCCCCAGGG -3'
(R):5'- CACAGCAGCGTTTTGTTGG -3'

Sequencing Primer
(F):5'- CTGTACTGATGGAGGATAATAAGTTG -3'
(R):5'- TTGGGGAGCGCAGATGC -3'
Posted On 2019-10-17