Incidental Mutation 'R0634:Wdr62'
ID58145
Institutional Source Beutler Lab
Gene Symbol Wdr62
Ensembl Gene ENSMUSG00000037020
Gene NameWD repeat domain 62
Synonyms2310038K02Rik
MMRRC Submission 038823-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0634 (G1)
Quality Score215
Status Validated
Chromosome7
Chromosomal Location30240138-30280419 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30270174 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 287 (V287A)
Ref Sequence ENSEMBL: ENSMUSP00000103825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108190] [ENSMUST00000145027]
Predicted Effect probably damaging
Transcript: ENSMUST00000108190
AA Change: V287A

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103825
Gene: ENSMUSG00000037020
AA Change: V287A

DomainStartEndE-ValueType
low complexity region 27 53 N/A INTRINSIC
WD40 101 142 4.24e-3 SMART
WD40 145 186 1.03e-1 SMART
WD40 189 226 7.4e0 SMART
WD40 284 322 3.55e1 SMART
WD40 353 388 1.85e0 SMART
WD40 395 442 2.98e-1 SMART
WD40 482 521 2.77e-1 SMART
WD40 524 566 2.3e0 SMART
WD40 570 610 4.18e-2 SMART
WD40 615 657 1.54e0 SMART
WD40 660 702 8.49e-3 SMART
WD40 705 744 3.61e-6 SMART
low complexity region 763 768 N/A INTRINSIC
low complexity region 797 811 N/A INTRINSIC
low complexity region 980 987 N/A INTRINSIC
low complexity region 1215 1226 N/A INTRINSIC
low complexity region 1302 1313 N/A INTRINSIC
low complexity region 1477 1497 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145027
AA Change: V287A

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000116772
Gene: ENSMUSG00000037020
AA Change: V287A

DomainStartEndE-ValueType
low complexity region 27 53 N/A INTRINSIC
WD40 101 142 4.24e-3 SMART
WD40 145 186 1.03e-1 SMART
WD40 189 226 7.4e0 SMART
WD40 284 322 3.55e1 SMART
WD40 353 388 1.85e0 SMART
WD40 395 442 2.98e-1 SMART
WD40 482 521 2.77e-1 SMART
WD40 524 566 2.3e0 SMART
WD40 570 610 4.18e-2 SMART
WD40 615 657 1.54e0 SMART
WD40 660 702 8.49e-3 SMART
WD40 705 744 3.61e-6 SMART
low complexity region 763 768 N/A INTRINSIC
low complexity region 797 811 N/A INTRINSIC
low complexity region 980 987 N/A INTRINSIC
Meta Mutation Damage Score 0.1491 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.2%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is proposed to play a role in cerebral cortical development. Mutations in this gene have been associated with microencephaly, cortical malformations, and mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice for a hypomorphic allele exhibit reduced brain size due to decreased neural progenitor cells. Cells show spindle instability, spindle assembly checkpoint activation, mitotic arrest and cell death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,314,491 I2958V possibly damaging Het
Adam21 C A 12: 81,560,352 W212L probably benign Het
Adcy2 A C 13: 68,727,945 H479Q possibly damaging Het
Adcy4 T C 14: 55,781,597 R168G probably benign Het
Atp13a2 T C 4: 141,006,929 probably benign Het
C1ra G A 6: 124,517,505 E304K possibly damaging Het
C87977 A G 4: 144,209,340 probably null Het
Cc2d2a A C 5: 43,681,381 probably benign Het
Cenpe T C 3: 135,246,827 L1426P probably damaging Het
Cntn1 A T 15: 92,314,563 R869* probably null Het
Creb3l2 A T 6: 37,334,348 probably benign Het
Crybg2 G A 4: 134,075,304 probably benign Het
Csmd1 A T 8: 16,226,391 F800I probably damaging Het
Dock6 G A 9: 21,841,527 T330I probably damaging Het
Ets2 G A 16: 95,716,156 E311K possibly damaging Het
Fbxo22 A T 9: 55,214,960 Q141L probably benign Het
Fer C T 17: 64,035,508 T223M probably benign Het
Gm13757 A T 2: 88,446,617 M107K probably benign Het
Gm9774 C T 3: 92,428,809 W125* probably null Het
Gtf3c1 A T 7: 125,657,477 probably benign Het
Gtf3c2 G A 5: 31,159,806 R684* probably null Het
Hs6st3 T A 14: 119,869,062 L294* probably null Het
Ighg2c T G 12: 113,287,964 E181A unknown Het
Igkv6-15 A T 6: 70,406,779 probably benign Het
Lrmp A T 6: 145,174,628 H523L probably damaging Het
Map2k6 C T 11: 110,494,343 R178* probably null Het
Meikin T A 11: 54,390,483 D126E probably benign Het
Mgst1 A T 6: 138,156,331 T37S probably damaging Het
Mrc2 G A 11: 105,347,692 V1222M probably benign Het
Myom2 C A 8: 15,119,216 probably benign Het
Negr1 A G 3: 157,016,266 K159R possibly damaging Het
Nptx1 T C 11: 119,543,301 T320A possibly damaging Het
Olfr490 T C 7: 108,286,296 I277V probably benign Het
Olfr530 A T 7: 140,373,397 V71E possibly damaging Het
Pes1 C T 11: 3,977,794 probably benign Het
Pes1 T G 11: 3,977,795 probably benign Het
Pkhd1 A T 1: 20,117,474 Y3537N probably damaging Het
Poteg G A 8: 27,473,587 G289R probably benign Het
Rassf5 T C 1: 131,244,956 R59G probably damaging Het
Reln A T 5: 22,018,869 W961R probably damaging Het
Rhot2 G A 17: 25,842,028 H168Y possibly damaging Het
Ripk3 G T 14: 55,788,391 probably benign Het
Samm50 A G 15: 84,214,171 silent Het
Sap30bp T C 11: 115,957,403 I117T probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Sipa1l2 A T 8: 125,422,624 L1632* probably null Het
Sirt7 T C 11: 120,622,129 probably benign Het
Smg8 T C 11: 87,086,108 T216A possibly damaging Het
Sox9 A G 11: 112,784,942 Y319C probably damaging Het
Sspn G A 6: 145,961,151 A27T possibly damaging Het
Suco A G 1: 161,838,804 V509A possibly damaging Het
Svep1 C T 4: 58,070,661 C2375Y possibly damaging Het
Trbv21 T A 6: 41,203,050 probably benign Het
Uimc1 C T 13: 55,060,266 E455K possibly damaging Het
Upk3b A G 5: 136,040,076 T100A possibly damaging Het
Usp47 A G 7: 112,108,655 N1303D probably damaging Het
Vav1 A T 17: 57,303,862 D476V probably benign Het
Vmn1r68 A G 7: 10,527,235 V312A probably benign Het
Zcchc4 C T 5: 52,783,208 P40S probably benign Het
Zfp326 T A 5: 105,886,203 Y26* probably null Het
Zfp592 A G 7: 81,038,071 H915R probably damaging Het
Other mutations in Wdr62
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Wdr62 APN 7 30243523 missense probably benign 0.00
IGL00428:Wdr62 APN 7 30270752 missense probably damaging 0.99
IGL00579:Wdr62 APN 7 30267895 missense probably damaging 1.00
IGL00709:Wdr62 APN 7 30242061 missense probably benign 0.05
IGL00924:Wdr62 APN 7 30265218 missense probably damaging 0.99
IGL00924:Wdr62 APN 7 30242806 missense probably damaging 1.00
IGL00956:Wdr62 APN 7 30261339 missense probably damaging 0.96
IGL01016:Wdr62 APN 7 30254251 missense probably benign 0.39
IGL01118:Wdr62 APN 7 30242781 missense probably damaging 0.96
IGL01458:Wdr62 APN 7 30241762 missense probably benign 0.08
IGL01977:Wdr62 APN 7 30258101 missense probably damaging 1.00
IGL02065:Wdr62 APN 7 30243469 missense possibly damaging 0.59
IGL02155:Wdr62 APN 7 30262643 missense probably damaging 1.00
IGL02260:Wdr62 APN 7 30270782 missense probably damaging 1.00
IGL02404:Wdr62 APN 7 30267873 missense probably damaging 1.00
IGL02491:Wdr62 APN 7 30242759 missense probably benign 0.19
IGL02556:Wdr62 APN 7 30245284 splice site probably null
IGL02739:Wdr62 APN 7 30242460 nonsense probably null
IGL03387:Wdr62 APN 7 30270774 missense possibly damaging 0.90
I0000:Wdr62 UTSW 7 30245327 missense probably benign 0.03
R0304:Wdr62 UTSW 7 30242874 missense probably benign 0.20
R0371:Wdr62 UTSW 7 30242158 missense possibly damaging 0.56
R0400:Wdr62 UTSW 7 30241462 missense possibly damaging 0.81
R0621:Wdr62 UTSW 7 30254061 missense possibly damaging 0.94
R1758:Wdr62 UTSW 7 30267903 missense probably damaging 1.00
R2205:Wdr62 UTSW 7 30258149 critical splice acceptor site probably null
R2254:Wdr62 UTSW 7 30267903 missense probably damaging 0.97
R2255:Wdr62 UTSW 7 30267903 missense probably damaging 0.97
R2566:Wdr62 UTSW 7 30273999 missense probably damaging 1.00
R2851:Wdr62 UTSW 7 30261437 missense possibly damaging 0.70
R3150:Wdr62 UTSW 7 30271670 missense possibly damaging 0.94
R4355:Wdr62 UTSW 7 30242248 missense probably damaging 1.00
R4517:Wdr62 UTSW 7 30270258 missense probably damaging 1.00
R4839:Wdr62 UTSW 7 30241465 missense probably benign 0.00
R4839:Wdr62 UTSW 7 30270686 missense probably damaging 1.00
R5193:Wdr62 UTSW 7 30265167 missense probably damaging 0.99
R5289:Wdr62 UTSW 7 30267875 missense probably damaging 1.00
R5306:Wdr62 UTSW 7 30265263 missense possibly damaging 0.94
R5878:Wdr62 UTSW 7 30241347 missense probably benign
R5942:Wdr62 UTSW 7 30243079 nonsense probably null
R6051:Wdr62 UTSW 7 30261384 missense possibly damaging 0.69
R6237:Wdr62 UTSW 7 30242435 missense probably damaging 1.00
R6727:Wdr62 UTSW 7 30271620 missense probably damaging 1.00
R7158:Wdr62 UTSW 7 30270738 missense possibly damaging 0.77
R7208:Wdr62 UTSW 7 30252336 missense probably damaging 0.97
R7237:Wdr62 UTSW 7 30270444 intron probably null
R7336:Wdr62 UTSW 7 30243917 missense probably damaging 0.98
R7559:Wdr62 UTSW 7 30270773 missense probably damaging 0.98
R7845:Wdr62 UTSW 7 30265242 missense possibly damaging 0.79
R7928:Wdr62 UTSW 7 30265242 missense possibly damaging 0.79
R8002:Wdr62 UTSW 7 30252360 missense not run
Z1176:Wdr62 UTSW 7 30255928 missense not run
Predicted Primers PCR Primer
(F):5'- AAGAGTCACGCATGGAACCTGTGCTG -3'
(R):5'- TGCACCCATTATGGTCAGGTCTCAGAG -3'

Sequencing Primer
(F):5'- tgcacacctgcaatccc -3'
(R):5'- CCAGCTTCTTGGGCATAAAAGTG -3'
Posted On2013-07-11