Incidental Mutation 'R7501:Ppp1r26'
ID581453
Institutional Source Beutler Lab
Gene Symbol Ppp1r26
Ensembl Gene ENSMUSG00000035829
Gene Nameprotein phosphatase 1, regulatory subunit 26
SynonymsLOC241289
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7501 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location28446800-28455508 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 28450737 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 126 (D126E)
Ref Sequence ENSEMBL: ENSMUSP00000042173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040324] [ENSMUST00000189694]
Predicted Effect probably damaging
Transcript: ENSMUST00000040324
AA Change: D126E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042173
Gene: ENSMUSG00000035829
AA Change: D126E

DomainStartEndE-ValueType
Pfam:PPP1R26_N 1 812 N/A PFAM
low complexity region 901 913 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189694
AA Change: D126E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139546
Gene: ENSMUSG00000035829
AA Change: D126E

DomainStartEndE-ValueType
low complexity region 122 132 N/A INTRINSIC
low complexity region 487 504 N/A INTRINSIC
low complexity region 515 536 N/A INTRINSIC
low complexity region 551 559 N/A INTRINSIC
low complexity region 636 654 N/A INTRINSIC
low complexity region 766 780 N/A INTRINSIC
low complexity region 901 913 N/A INTRINSIC
Meta Mutation Damage Score 0.1436 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 A G 3: 36,088,825 N503S probably benign Het
Adam1a C T 5: 121,518,948 A761T possibly damaging Het
Amn1 C T 6: 149,185,031 M44I probably benign Het
Ankrd44 T C 1: 54,649,363 E238G Het
Ap3b2 A T 7: 81,473,446 I440K probably damaging Het
Atp2a1 G A 7: 126,450,172 T566I probably benign Het
B3galnt1 T C 3: 69,575,299 I210V probably benign Het
Bag5 T C 12: 111,710,288 K367R probably benign Het
Cdc25b T C 2: 131,194,160 Y410H probably damaging Het
Cgref1 G T 5: 30,945,456 P7Q probably damaging Het
Cnot6 T C 11: 49,685,332 I136V probably benign Het
Comp A G 8: 70,379,409 D500G possibly damaging Het
Dnah7b T C 1: 46,356,554 L3872P probably damaging Het
Dync2h1 A T 9: 7,175,336 L91Q possibly damaging Het
Fancd2 T C 6: 113,548,403 V280A possibly damaging Het
Fat4 T A 3: 38,958,448 Y2297* probably null Het
Fem1c A T 18: 46,505,801 M378K probably damaging Het
Gata6 A G 18: 11,054,082 T4A probably damaging Het
Gatb G C 3: 85,636,990 V422L probably damaging Het
Gfpt1 T A 6: 87,082,526 D510E probably benign Het
Gm12394 T C 4: 42,791,357 E925G probably damaging Het
Gria4 A T 9: 4,502,436 Y366N probably benign Het
Gucy1b1 T C 3: 82,035,359 H492R probably damaging Het
Hecw2 T C 1: 53,913,872 probably null Het
Hist1h2be A G 13: 23,585,793 I55T possibly damaging Het
Hnrnph1 A C 11: 50,379,556 E62D probably benign Het
Itga2 A G 13: 114,875,559 V274A probably damaging Het
Kdm5d T A Y: 941,488 W1230R probably damaging Het
Lctl A T 9: 64,131,579 M317L probably benign Het
Lrp6 T C 6: 134,486,508 D570G probably damaging Het
Lrrc9 G T 12: 72,449,716 M39I probably damaging Het
Ltbp2 A T 12: 84,830,645 I402N probably damaging Het
Mst1 G A 9: 108,082,549 G297D probably damaging Het
Muc6 G C 7: 141,637,746 P2338R probably damaging Het
Nbr1 G A 11: 101,566,200 R163Q probably damaging Het
Nlrp4f A G 13: 65,194,329 F501L probably damaging Het
Nup133 A C 8: 123,922,414 I563S probably benign Het
Oacyl T G 18: 65,725,298 probably null Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Plxna2 C T 1: 194,643,895 R46C possibly damaging Het
Prl6a1 A T 13: 27,316,299 R84S possibly damaging Het
Ptprz1 C T 6: 23,001,747 Q1279* probably null Het
Ptx4 C T 17: 25,125,192 T472I possibly damaging Het
Rabgap1l A G 1: 160,700,788 V416A probably damaging Het
Rbfox2 A T 15: 77,105,634 D231E probably benign Het
Reln A T 5: 22,227,638 F121L possibly damaging Het
Rfx7 G A 9: 72,616,772 V415I probably benign Het
Scaf4 A T 16: 90,230,076 M951K unknown Het
Sdf4 T C 4: 155,996,520 probably null Het
Sec16a T C 2: 26,441,851 T51A probably damaging Het
Sema3a A G 5: 13,557,041 N281S probably damaging Het
Snai2 G A 16: 14,706,890 V87I possibly damaging Het
Synj2 T A 17: 5,990,239 S197T possibly damaging Het
Syt6 A T 3: 103,587,702 M328L probably benign Het
Tdrd12 A G 7: 35,478,091 V946A unknown Het
Trat1 A T 16: 48,754,294 probably null Het
Vmn1r75 T A 7: 11,881,070 I243K possibly damaging Het
Vmn2r83 G A 10: 79,491,937 C793Y probably damaging Het
Wnt9a G A 11: 59,328,757 G203D probably damaging Het
Xrn2 T C 2: 147,029,756 I366T probably damaging Het
Zfp280d A G 9: 72,361,942 D787G possibly damaging Het
Zfp706 T C 15: 37,001,925 T53A probably damaging Het
Other mutations in Ppp1r26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Ppp1r26 APN 2 28453718 missense probably damaging 1.00
IGL01092:Ppp1r26 APN 2 28453860 utr 3 prime probably benign
IGL02061:Ppp1r26 APN 2 28450627 missense possibly damaging 0.68
IGL02399:Ppp1r26 APN 2 28453280 missense probably benign
R0518:Ppp1r26 UTSW 2 28452302 missense probably damaging 1.00
R0763:Ppp1r26 UTSW 2 28450367 missense probably damaging 1.00
R1082:Ppp1r26 UTSW 2 28452134 missense probably damaging 1.00
R1477:Ppp1r26 UTSW 2 28452788 missense probably benign 0.00
R1512:Ppp1r26 UTSW 2 28451516 missense probably benign 0.01
R2157:Ppp1r26 UTSW 2 28452358 missense probably benign 0.00
R2228:Ppp1r26 UTSW 2 28453786 missense possibly damaging 0.91
R2275:Ppp1r26 UTSW 2 28452701 missense possibly damaging 0.86
R3015:Ppp1r26 UTSW 2 28452302 missense probably damaging 1.00
R4402:Ppp1r26 UTSW 2 28451606 missense probably benign 0.00
R4614:Ppp1r26 UTSW 2 28450848 missense probably benign 0.04
R5521:Ppp1r26 UTSW 2 28451426 missense probably benign 0.27
R5873:Ppp1r26 UTSW 2 28451605 missense probably benign 0.10
R5988:Ppp1r26 UTSW 2 28452554 missense probably benign 0.01
R6060:Ppp1r26 UTSW 2 28451030 missense probably benign 0.00
R7007:Ppp1r26 UTSW 2 28451159 missense probably damaging 0.99
Z1176:Ppp1r26 UTSW 2 28452847 missense probably damaging 1.00
Z1177:Ppp1r26 UTSW 2 28450892 missense probably benign 0.17
Z1177:Ppp1r26 UTSW 2 28452868 missense probably benign 0.45
Z1177:Ppp1r26 UTSW 2 28453480 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGAGCGTCTCACCCAAAGAG -3'
(R):5'- TTCAAAGGAGTCCTCGCTG -3'

Sequencing Primer
(F):5'- CCAAAGAGGCCAACGTGCAG -3'
(R):5'- AAAGGAGTCCTCGCTGCTCATG -3'
Posted On2019-10-17