Incidental Mutation 'R7501:Cdc25b'
ID581454
Institutional Source Beutler Lab
Gene Symbol Cdc25b
Ensembl Gene ENSMUSG00000027330
Gene Namecell division cycle 25B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7501 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location131186949-131198497 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 131194160 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 410 (Y410H)
Ref Sequence ENSEMBL: ENSMUSP00000028804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028804] [ENSMUST00000079857]
Predicted Effect probably damaging
Transcript: ENSMUST00000028804
AA Change: Y410H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028804
Gene: ENSMUSG00000027330
AA Change: Y410H

DomainStartEndE-ValueType
low complexity region 86 105 N/A INTRINSIC
Pfam:M-inducer_phosp 111 379 3.3e-103 PFAM
RHOD 417 531 4.29e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000079857
AA Change: Y384H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078784
Gene: ENSMUSG00000027330
AA Change: Y384H

DomainStartEndE-ValueType
low complexity region 86 105 N/A INTRINSIC
Pfam:M-inducer_phosp 111 354 2.4e-78 PFAM
RHOD 391 505 4.29e-26 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CDC25B is a member of the CDC25 family of phosphatases. CDC25B activates the cyclin dependent kinase CDC2 by removing two phosphate groups and it is required for entry into mitosis. CDC25B shuttles between the nucleus and the cytoplasm due to nuclear localization and nuclear export signals. The protein is nuclear in the M and G1 phases of the cell cycle and moves to the cytoplasm during S and G2. CDC25B has oncogenic properties, although its role in tumor formation has not been determined. Multiple transcript variants for this gene exist. [provided by RefSeq, Jul 2008]
PHENOTYPE: The resumption of meiosis during oocyte maturation is blocked in homozygous mutant female mice, resulting in female infertility. Male mice do not show an overt reproductive phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 A G 3: 36,088,825 N503S probably benign Het
Adam1a C T 5: 121,518,948 A761T possibly damaging Het
Amn1 C T 6: 149,185,031 M44I probably benign Het
Ankrd44 T C 1: 54,649,363 E238G Het
Ap3b2 A T 7: 81,473,446 I440K probably damaging Het
Atp2a1 G A 7: 126,450,172 T566I probably benign Het
B3galnt1 T C 3: 69,575,299 I210V probably benign Het
Bag5 T C 12: 111,710,288 K367R probably benign Het
Cgref1 G T 5: 30,945,456 P7Q probably damaging Het
Cnot6 T C 11: 49,685,332 I136V probably benign Het
Comp A G 8: 70,379,409 D500G possibly damaging Het
Dnah7b T C 1: 46,356,554 L3872P probably damaging Het
Dync2h1 A T 9: 7,175,336 L91Q possibly damaging Het
Fancd2 T C 6: 113,548,403 V280A possibly damaging Het
Fat4 T A 3: 38,958,448 Y2297* probably null Het
Fem1c A T 18: 46,505,801 M378K probably damaging Het
Gata6 A G 18: 11,054,082 T4A probably damaging Het
Gatb G C 3: 85,636,990 V422L probably damaging Het
Gfpt1 T A 6: 87,082,526 D510E probably benign Het
Gm12394 T C 4: 42,791,357 E925G probably damaging Het
Gria4 A T 9: 4,502,436 Y366N probably benign Het
Gucy1b1 T C 3: 82,035,359 H492R probably damaging Het
Hecw2 T C 1: 53,913,872 probably null Het
Hist1h2be A G 13: 23,585,793 I55T possibly damaging Het
Hnrnph1 A C 11: 50,379,556 E62D probably benign Het
Itga2 A G 13: 114,875,559 V274A probably damaging Het
Kdm5d T A Y: 941,488 W1230R probably damaging Het
Lctl A T 9: 64,131,579 M317L probably benign Het
Lrp6 T C 6: 134,486,508 D570G probably damaging Het
Lrrc9 G T 12: 72,449,716 M39I probably damaging Het
Ltbp2 A T 12: 84,830,645 I402N probably damaging Het
Mst1 G A 9: 108,082,549 G297D probably damaging Het
Muc6 G C 7: 141,637,746 P2338R probably damaging Het
Nbr1 G A 11: 101,566,200 R163Q probably damaging Het
Nlrp4f A G 13: 65,194,329 F501L probably damaging Het
Nup133 A C 8: 123,922,414 I563S probably benign Het
Oacyl T G 18: 65,725,298 probably null Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Plxna2 C T 1: 194,643,895 R46C possibly damaging Het
Ppp1r26 T A 2: 28,450,737 D126E probably damaging Het
Prl6a1 A T 13: 27,316,299 R84S possibly damaging Het
Ptprz1 C T 6: 23,001,747 Q1279* probably null Het
Ptx4 C T 17: 25,125,192 T472I possibly damaging Het
Rabgap1l A G 1: 160,700,788 V416A probably damaging Het
Rbfox2 A T 15: 77,105,634 D231E probably benign Het
Reln A T 5: 22,227,638 F121L possibly damaging Het
Rfx7 G A 9: 72,616,772 V415I probably benign Het
Scaf4 A T 16: 90,230,076 M951K unknown Het
Sdf4 T C 4: 155,996,520 probably null Het
Sec16a T C 2: 26,441,851 T51A probably damaging Het
Sema3a A G 5: 13,557,041 N281S probably damaging Het
Snai2 G A 16: 14,706,890 V87I possibly damaging Het
Synj2 T A 17: 5,990,239 S197T possibly damaging Het
Syt6 A T 3: 103,587,702 M328L probably benign Het
Tdrd12 A G 7: 35,478,091 V946A unknown Het
Trat1 A T 16: 48,754,294 probably null Het
Vmn1r75 T A 7: 11,881,070 I243K possibly damaging Het
Vmn2r83 G A 10: 79,491,937 C793Y probably damaging Het
Wnt9a G A 11: 59,328,757 G203D probably damaging Het
Xrn2 T C 2: 147,029,756 I366T probably damaging Het
Zfp280d A G 9: 72,361,942 D787G possibly damaging Het
Zfp706 T C 15: 37,001,925 T53A probably damaging Het
Other mutations in Cdc25b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03230:Cdc25b APN 2 131188140 missense probably benign 0.00
R0471:Cdc25b UTSW 2 131197284 missense probably damaging 0.99
R0639:Cdc25b UTSW 2 131197262 missense probably benign 0.00
R0645:Cdc25b UTSW 2 131191613 missense probably benign 0.06
R0673:Cdc25b UTSW 2 131197262 missense probably benign 0.00
R1574:Cdc25b UTSW 2 131191137 splice site probably benign
R4094:Cdc25b UTSW 2 131189117 missense probably benign
R4433:Cdc25b UTSW 2 131191698 missense probably benign 0.02
R4722:Cdc25b UTSW 2 131193351 missense probably damaging 1.00
R4817:Cdc25b UTSW 2 131193303 missense probably damaging 1.00
R4957:Cdc25b UTSW 2 131193605 missense possibly damaging 0.80
R5345:Cdc25b UTSW 2 131192596 missense probably benign 0.18
R5407:Cdc25b UTSW 2 131193647 missense probably damaging 1.00
R5562:Cdc25b UTSW 2 131194758 missense probably damaging 1.00
R5594:Cdc25b UTSW 2 131191618 missense probably damaging 1.00
R5792:Cdc25b UTSW 2 131191759 missense probably damaging 1.00
R5831:Cdc25b UTSW 2 131187381 critical splice donor site probably null
R7204:Cdc25b UTSW 2 131191632 missense probably damaging 1.00
R7292:Cdc25b UTSW 2 131191173 missense probably damaging 1.00
R7399:Cdc25b UTSW 2 131194654 missense probably damaging 1.00
R7772:Cdc25b UTSW 2 131189109 missense probably damaging 1.00
R8186:Cdc25b UTSW 2 131189130 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GCAGAAGGTTCTTTCCCTGG -3'
(R):5'- GCTGAACTTGCCTGTTAACAG -3'

Sequencing Primer
(F):5'- CAGAAGGTTCTTTCCCTGGGTATG -3'
(R):5'- TGTTAACAGGGCCACCATCTGTAG -3'
Posted On2019-10-17